www.losandes.com.ar website review
Improve your SEO :: free trial!
www.losandes.com.ar is 66% geoptimaliseerd!
SEO Keyword summary for www.losandes.com.ar/automotores/estas-fueron-las-marcas-de-autos-mas-vendidas-en-el-pais-en-noviembre-de-2023/
Keywords are extracted from the main content of your website and are the primary indicator of the words this page could rank for. By frequenty count we expect your focus keyword to be los
Focus keyword
Short and long tail
Short Tail Keywords los con del |
long Tail Keywords (2 words) los andeshace los ltimos el toyota ltimos meses tercer lugar |
long Tail Keywords (3 words) los ltimos meses por 40mo mes mes de los lder por 40mo es lder por cronos es lder fiat cronos es |
www.losandes.com.ar On-Page SEO Scan
Descriptive Elements
The <head> element of a www.losandes.com.ar/automotores/estas-fueron-las-marcas-de-autos-mas-vendidas-en-el-pais-en-noviembre-de-2023/ page is used to inform the browser and visitors of the page about the general meta information. The head section of the page is where we place the page title, the definition of the HTML version used, the language of in which the page is written. In the head section we can also include JavaScript and CSS (markup) files for the page.
Page title
Title length
estas fueron las marcas autos maacutes vendidas paiacutes noviembre
Meta description
Meta description legth
Meta description SEO
fiat cronos lder por mes los ltimos meses segundo lugar posicion peugeot tercer toyota etios
Content SEO
Number of Words
Spam detected?
Headings
Heading distribution
Heading normalisation
Heading SEO impact
Emphasis (bold and italic)
Emphasis SEO impact
Images
Number of images
Images dimensions
Image alt descriptions
Images SEO impact
cerrar menu logo los andes facebook twitter instagram youtube redaccin fiat cronos lder por mes ltimos meses gentileza camioneta amarok fue pickup mediana que acumul ventas autocosmos chevrolet tracker mantiene como del segmento con unidades nacin expositores seminario argentina oro plata cobre saqueos remate autos guaymalln archivo afip soar aguinaldo jubilados botas para invierno lionel messi mercado pago meteoritos papa jess buen pastor vitral jueves cul signo mala suerte hoy risotto championes estamos todas podcast bicicleta trek avin tard despegar casi choca edificios tragedia junn muri joven motociclista tras chocar contra rbol ministerio seguridad copa cinthia fernndez mximo thomsen victoria villarruel sesion senado tina serrano sara rosales paulina rubio visit susana present nuevo disco mara laura belvedere apareci yaguaret corrientes navegante rosarino logr ser primer argentino cruzar atlntico vela cuarto adzocalo white wyleex
Mobile SEO www.losandes.com.ar/automotores/estas-fueron-las-marcas-de-autos-mas-vendidas-en-el-pais-en-noviembre-de-2023/
Mobile rendering
Mobile optimizations
Responsive design detected (mobile css)
No flash detected !
Mobile improvement
Marketing / lead generation for www.losandes.com.ar/automotores/estas-fueron-las-marcas-de-autos-mas-vendidas-en-el-pais-en-noviembre-de-2023/
Social Media
Facebook shares | Facebook likes | ||
Facebook comments | Tweets | ||
Google +1 |
Conversion form
Search form
Analytics
Online presence
SERP Preview
SERP Title
The title is trucated
SERP Link
SERP Description
Domain Level SEO
Domain name
19 characters long
Domain name SEO Impact
los found in domain name !
Path name
autos found in path !
fue found in path !
fueron found in path !
las found in path !
noviembre found in path !
Structured data
Publisher Markup
Other Structured data
Website configuration
Correct processing of non-existing pages?
Favicon icon found?
HTML request without WWW redirected correctly?
Robots.txt found?
Sitemap found?
Navigation and internal links
Navigation
Url seperator
Human readable urls
Number of links
Link SEO Impact
ver promos de suscripcin
los andes
clasificados
auditorio
cmo anunciar
publicity
publicity
los andes san juan
|
autor redaccin los andes
ramiro vias
roco ledesma
maia had
lisandro tosello
|
economia la expectativa de cambio relaj un poco a los mineros
aument la venta de autos usados en abril cules fueron los 10 modelos ms elegidos
en un plan de ahorro la afip rematar parte de su flota de vehculos cunto cuestan y qu modelos hay
jubilados y pensionados as qued el monto del mes de junio con bono y aguinaldo
chau plazo fijo cunto hay que invertir en mercado pago para obtener una ganancia de 250 mil
sorpresa por los precios en chile cunto sale una bicicleta de montaa trek
|
espectaculo que te la hagan parir cinthia fernndez le dijo de todo a mximo thomsen
muri la reconocida actriz tina serrano a los 82 aos
sara rosales fue reconocida como personalidad trascendente en las artes
la sofocante ola de calor en mxico no le impidi a paulina rubio viajar con un inslito atuendo
|
estilo chau zapatillas hola botas estos son los 3 modelos de calzado infaltables para no pasar fro en el invierno
|
intent |
mas-deportes tena da libre pero lionel messi decidi demostrar por qu es el mejor del mundo
copa argentina independiente rivadavia pierde con banfield por 21
|
mundo un avin tard en despegar y casi se estrella contra los edificios
|
policiales en menos de 24 horas hubo una ria con heridos un violento asalto y un choque en el mismo barrio de capital
gendarmera evit que salieran de mendoza con destino a chile 77 meteoritos valuados en us 400000
tragedia en junn muri un motociclista tras chocar contra un rbol
|
politica los jefes de bloques en el senado pidieron retrotraer el aumento en las dietas
|
por-las-redes qu significa soar con tener un auto nuevo puede estar pasndote algo dentro de poco tiempo
primer da internacional de la papa la mejor receta que se puede hacer con este tubrculo
el reconfortante signficado de soar que ests volando
el evangelio de hoy 30 de mayo jess hijo de david ten compasin de m
jueves 30 cul es el signo con ms mala suerte hoy
la receta ideal para cocinar cuando tens invitados en casa segn la inteligencia artificial
|
por-los-departamentos guaymalln prepara el ltimo remate de vehculos del ao
|
services cartelera de cine
cartelera de espectculos
|
sharer |
sociedad edicin impresa
estos son los autos y motos que rematarn en guaymalln solo se pueden ver hoy
mayra gmez en estamos todas hay bullying porque todava no sabemos educar en la diversidad
|
temas podcast
contenido exclusivo
autos
|
www.losandes.com.ar sociedad
poltica
economa
opinin
deportes
policiales
fincas
arquitectura
editorial
escribe al lector
espectculos
estilo
muy tecno
mundo club house
sociales
turismo
vecinos
receptorias
ms de autos
por las redes
|
Links to external pages
Outloing links
losandes2.mitiendanube.com
www.guarda14.com
www.guarda14.com
losandespass.com.ar
www.rumbosdigital.com
losandes2.mitiendanube.com
tintero.com.ar
eventos.losandespass.com.ar
www.facebook.com
www.youtube.com
viapais.com.ar
viapais.com.ar
viapais.com.ar
viapais.com.ar
viapais.com.ar
www.lavoz.com.ar
www.lavoz.com.ar
www.clarin.com
www.ole.com.ar
entremujeres.clarin.com
www.viapais.com.ar
www.tycsports.com
tn.com.ar
www.ciudad.com.ar
www.eltrecetv.com.ar
radiomitre.cienradios.com
la100.cienradios.com
ar.cienradios.com
www.wyleex.com
SEO Advice for www.losandes.com.ar
In this section we provide pointers on how you can to optimize your web page so it can be found more easily by search engines and how to make it rank higher by optimizing the content of the page itself. For each of the individual criteria the maximum score is 100%. A score below 70% is considered to be indication that the page is not complying with general SEO standards and should be evaluated and/or fixed. Not every factor is weighted the same and some are not as important as others. Relatively unimportant factors like meta keywords are not included in the overall score.
Item | Factor | Pointers | |
---|---|---|---|
PageTitle | 100% | Far too many sites lack a page title. A page title is the first thing that shows in the search results so always use the title element. | |
Title relevance | 57% | A title should reflect the contents of a site. This site has a 44 % match | |
Title Length | 70% | Limit your title to anywhere between 40 and 70 characters. Your title was 92 characters long | |
Meta Description | 100% | A meta description is the second element that shows in the search results so always use the meta description. | |
Meta description length | 85% | The meta description should be between 145 and 160 characters. This meta description is 142 characters long. | |
Meta description relevance | 100% | Meta Description should reflect the contents of a site. This site has a 73 % match | |
Number of internal links | 50% | Linking to internal pages makes pages easier to find for search engines. Try to keep the number of links on your page roughly below 100. There are 161 internal links on this page. | |
Folder structure | 100% | We found a folder structure in the links on your page. A good folder structure makes a site easier to navigate. We found 15 level 1 folders and 20 folders above or in the first level of navigation. | |
Headings | 23% | Headers should reflect the contents of a site. This site has a 10 % match | |
Links | 12% | Link anchors should to some degree reflect the contents of a site. This site has a 6 % match | |
Image alt tags | 48% | Image alt tags should to some degree reflect the contents of a site. This site has a 17 % match | |
Bold and italic | 100% | Bold and italic tags should reflect the contents of a site to some degree. This site has a 44 % match | |
Html ratio | 30% | Try to keep the html / text ratio as low as possible. More html means longer loading times. Layout should be handled in a serpate css file | |
Image descriptions | 92% | 91.525423728814 % of all images have been described via the "alt" attribute. Describing images with relevant text may lead to better results in the search engines. | |
Page errors | 100% | Pages with no errors display significantly faster on most browsers. We detected 0 errors and warnings | |
WordCount | 55% | An ideal page contains between 400 and 600 words.This page contains 1190 words | |
Server response time | 30% | A slow server slows down a website. This server responds 1127.91% slower the average | |
Gzip Compression | 100% | This site uses Gzip compression to display faster | |
Keywords in Domainname | 100% | There are important keywords in your domain name | |
Keywords in domain path | 100% | There are important keywords in the domain path | |
Structured Data | 100% | Structured data makes it easier for search engines to index your website | |
Inline css | 0% | Do not use inline css declarations. Inline css will slow down the rendering of the website. We detected 36 inline style declarations ( <a style="color:green">) with a size of 1159 bytes | |
Excessive use of the same words | 100% | There is no indication that there are one or more keywords that are used excessively. | |
Frames or iframes | 20% | The use of (i)frames can lead to problems crawling your page. Wij found 1 frame(s) on your page | |
Flash | 100% | Perfect, we detected no flash objects on your page | |
Css | 100% | Perfect, we did not detect too many CSS files | |
Javascript | 30% | Wij detected too much (10) blocking JavaScript files. Try to combine or defer the loading of JavaScript files | |
Mobile Website | 100% | Perfect, we found a responsive design for mobile users | |
Most important heading | 100% | Perfect, we detected a correct use of the most important (h1) heading! | |
Normalized headings | 40% | We dit not font a normalized heading structure. A heading 2 (h2) for example should be followed by a heading of an equal level (h2), a child heading (h3) or even a aprent heading (h1). |
How would you like to have SEO advice for all your pages ?? Start your SEO Dashboard and optimize your website!
www.losandes.com.ar images and descriptions
53 images found at www.losandes.com.ar Images can improve the user experience for a website by making a pag visually appealing Images can also add extra keyword relevance to a webpage by using alt tags. Images can also slow down a website. If the width and height for a picture is not specified for a browser know in advance how large the image is. A browser must first load the picture and see before it knows how much space should be on the page. Upon reservation In the meantime, the browser can do little but wait. When the height and width for the plate are given in the HTML code, a browser just continues to build for a page while the images load in the background.
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/close_white.svg?d=2195 height: 14px width: 12px description: cerrar |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/menu.svg?d=2195 height: 20px width: 17px description: menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/search.svg?d=2195 height: 20px width: 18px description: no alt description found |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/los-andes-140.svg?d=2195 height: 40px width: 160px description: los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/close.svg?d=2195 height: 18px width: 18px description: cerrar menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/chevron_down.svg?d=2195 height: 14px width: 12px description: no alt description found |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/facebook.svg?d=2195 height: 24px width: 24px description: facebook los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/x.svg?d=2195 height: 24px width: 24px description: twitter los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/instagram.svg?d=2195 height: 24px width: 24px description: instagram los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/youtube.svg?d=2195 height: 24px width: 24px description: youtube los andes |
|
https://www.losandes.com.ar/resizer/iuuu8a0ax-b3sx72bzfj1fuyvuc=/100x100/smart/s3.amazonaws.com/arc-authors/grupoclarin/3aad59e0-be62-4f05-a88d-4c88db2281b2.png height: 100px width: 100px description: redacción los andes |
|
https://www.losandes.com.ar/resizer/4kalda87zj3rmt5bcfj0wtepzui=/0x0:0x0/980x640/filters:quality(80):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/xdef55wsnjcbzmqkktijwdgnse.png height: 640px width: 980px description: el fiat cronos es líder por 40mo mes de los últimos meses. gentileza |
|
https://www.losandes.com.ar/resizer/ehq59h4xqppslpagm4axwyd5xma=/1023x767/smart/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/jvn7kf2awja2fmvjxseuc75nwu.png height: 767px width: 1023px description: la camioneta amarok fue la pick-up mediana que acumuló más ventas. gentileza: autocosmos. |
|
https://www.losandes.com.ar/resizer/pj1eljt3h7h3unopypu39ir1e9q=/1023x631/smart/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/i4xezuas6vappowz4dni6twana.png height: 631px width: 1023px description: la chevrolet tracker se mantiene como líder del segmento con 931 unidades. gentileza: la nación. |
|
https://www.losandes.com.ar/resizer/ak3t_swfsamokf7-gbme7jwyqxi=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/tkq2cjushvc45cdhuucpyryika.jpg height: 173px width: 307px description: los expositores en el seminario argentina, oro, plata y cobre. |
|
https://www.losandes.com.ar/resizer/4ldhhmp_sfgh_2ibcgfo2-vb9oy=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/knfmvmugdnd3bfyushdwgkxotq.jpg height: 173px width: 307px description: saqueos |
|
https://www.losandes.com.ar/resizer/kyiy9txj1acekrcezelygistvai=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/eask4udxlncihclctqgj6rvaku.jpg height: 173px width: 307px description: remate de autos en guaymallén |
|
https://www.losandes.com.ar/resizer/wxxq1lxesious4g8wyuankl_7jw=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/5ahzb5qr6jcwfimsacynjdwuvi.jpg height: 360px width: 640px description: remate de autos en guaymallén |
|
https://www.losandes.com.ar/resizer/5iirxbyxolz9v0h2h51fqcfhrrs=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/miydqzjvmjstayzwhfswmnjsge.jpg height: 360px width: 640px description: archivo / los andes |
|
https://www.losandes.com.ar/resizer/2viteb3hymfytpgguh16ns_h2la=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/i3q3u7ha2jhxpfi6zzxi7hbbqi.jpg height: 360px width: 640px description: afip |
|
https://www.losandes.com.ar/resizer/fwk3nmgr3ubgpvk3pixop_qfjds=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/6gsfhwksvzfqrffwrx3jurn2am.jpg height: 360px width: 640px description: soñar |
|
https://www.losandes.com.ar/resizer/8uocdiq6gla4npqjy2x2jebdsdc=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/n2zsjz3fcvdtdcjw4xmo3rywxm.jpg height: 88px width: 156px description: aguinaldo jubilados |
|
https://www.losandes.com.ar/resizer/lkrujfs7pziv8uslvsv589onxi8=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ieas54mzhvepbpin4egd6hkmt4.jpeg height: 88px width: 156px description: botas para el invierno |
|
https://www.losandes.com.ar/resizer/v93vemycb7fsuwtoiro56kpgitu=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/qqli542rwnbarhs55ae5pvnzke.jpg height: 88px width: 156px description: lionel messi |
|
https://www.losandes.com.ar/resizer/kt2hl2yyufd0hjvcse3ci3dxy2c=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/syh4x5yhafhythevgdmer6xqli.jpg height: 88px width: 156px description: mercado pago |
|
https://www.losandes.com.ar/resizer/xfeowdcbfess2ma3pnnpky3qqhs=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/gu75whtzpfemrbqrovoopdlryy.jpg height: 88px width: 156px description: meteoritos |
|
https://www.losandes.com.ar/resizer/pdu2cyy1hkgjcqxmlfcdrpjgkzi=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/aqaj4bs3jjazjgvt2w56m3qz34.jpg height: 88px width: 156px description: papa |
|
https://www.losandes.com.ar/resizer/davaq-axlizxeuw1x68jc04anhi=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/iwgra5dbxbdbrml6nqg6jnpoda.jpg height: 88px width: 156px description: soñar |
|
https://www.losandes.com.ar/resizer/jjyuujurcu2ivvxjtecmmzlwune=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/54xcuwx3uzhebdh4gdsg2bqraa.jpg height: 88px width: 156px description: jesús buen pastor vitral |
|
https://www.losandes.com.ar/resizer/pvnmtpv-otazekpvhdkqoq40w8g=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/aekxc4qxmzeq7jmd5fcghsllqu.jpeg height: 88px width: 156px description: jueves 30: cuál es el signo con más mala suerte hoy |
|
https://www.losandes.com.ar/resizer/bdzscxwigggoo3yg4olc8b0mb88=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/obdt3t4irrgahdxd22yh3p7d5m.png height: 88px width: 156px description: risotto con champiñones |
|
https://www.losandes.com.ar/resizer/-ahsahmupirnesw_jql_obr_bo8=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/a36ewtme4rdpbmsrtfb35cdewq.png height: 180px width: 360px description: ¿estamos todas? podcast |
|
https://www.losandes.com.ar/resizer/gddjl2ip33jmhgymqj42f500b2c=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/apxlxwv65vgopp6f7aivdmopru.jpg height: 180px width: 360px description: bicicleta trek |
|
https://www.losandes.com.ar/resizer/c7nlfpciefeldsaubfuudq1s-e0=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/3p2g667gazerblllngrr7jomgm.png height: 180px width: 360px description: un avión tardó en despegar y casi choca a los edificios |
|
https://www.losandes.com.ar/resizer/ge-ganmr0b-ie-czlwgdiimq4f8=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/jbiefp3dwnggrdtjqtkz4sjlfq.jpg height: 180px width: 360px description: tragedia en junín. murió un joven motociclista tras chocar contra un árbol. gentileza: ministerio de seguridad |
|
https://www.losandes.com.ar/resizer/rak8wrxmuwgxjqj9yvze4ywot2i=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/oqfotci5nbagtmocei3l4sznuy.jpg height: 180px width: 320px description: copa argentina |
|
https://www.losandes.com.ar/resizer/xmtjtafg1alycqrglzb_d_pyrj0=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/iuoie5b2mrb5tfyjvnykslvc4e.png height: 180px width: 320px description: cinthia fernández máximo thomsen |
|
https://www.losandes.com.ar/resizer/5n96-qcinq3ees4xrah3opskcrs=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ermxxp2x25dyxlpkvnhp5ja42i.jpg height: 180px width: 320px description: victoria villarruel sesion senado |
|
https://www.losandes.com.ar/resizer/n_lgegzkcft3fcyimkds74f4te4=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/xa55to42zngw3miicsol54kvxe.jpg height: 180px width: 320px description: tina serrano |
|
https://www.losandes.com.ar/resizer/yu0xtw7ccb5ysdswh_szcts6qpu=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/biqtt23uova6bjcprp3nksexy4.jpg height: 180px width: 320px description: sara rosales |
|
https://www.losandes.com.ar/resizer/mtxydkgpknh1fylsjwy2u-myrxw=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/wzr6hpc5xzhqrhdpwj6xgoyfke.jpg height: 180px width: 320px description: paulina rubio, visitó a susana y presentó su nuevo disco. |
|
https://www.losandes.com.ar/resizer/4pd-uuxhwfiwwuprsnceabjvjfa=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/c2jpyp4vh5garh2akpn2hq24dq.png height: 180px width: 360px description: maría laura belvedere |
|
https://www.losandes.com.ar/resizer/pkmm3bwg9ypos7m7qwmnadmlily=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/cf3r2dxtnfcv5legn37wit5si4.jpg height: 180px width: 360px description: apareció un nuevo yaguareté en corrientes. |
|
https://www.losandes.com.ar/resizer/wy1oaexjksg5acgpxbcsbgfart8=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/prbh4cujfzevtk7jo6k5y4q3vu.jpg height: 180px width: 360px description: el navegante rosarino que logró ser el primer argentino en cruzar el atlántico en vela. |
|
https://www.losandes.com.ar/resizer/p4yhfztqahwx892slhr608pmb1w=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/xfbbaqa2xbe2fcpyk3ab2ihyia.jpg height: 180px width: 360px description: río cuarto |
|
http://www.losandes.com.ar/data:image/png;base64,ivborw0kggoaaaansuheugaaaiaaaacacamaaad04jh5aaaaa3ncsvqicajb4u/
gaaaacxbiwxmaahycaab2hagnwnjqaaaagxrfwhrtb2z0d2fyzqb3d3cuaw5rc2nhcguub3jnm+48ggaaalhqtfrf/
///aaaaaqacaaaaaqacaaaaaqacaaaaaaaaaqacaqacaaaaaqacaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaqacaaa
aaaaaaqacaaaaaaaaaqacaaaaaaaaaqacaaaaaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaaaaaaaaaqacaaaaaaaaa
aaaaaaaaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaqacaqacaaaaaqacaaaaaaaaaqacaaaeaqacaaaeaqacaaaeaaa
eaqacaqacaaadaqacaaadaaadaqacaaadaaadaaadaqacaqacaqacaaadaaadaqacaqacaaacaqacaaacaaacaaaca
qacaaacaqacaaacaaacaqacagacaqacaqacaqacagacaqacagacaqacagacaqacagacagacagacagacagacaqacaga
cagacaqacaqacagacagacaqacagacagacagacagacagacaqacaqacagacagacaqacaqacaqabaqabaqabaqabaqaca
qabaqacaqabaqacaqabaqabaqacaqabaqabaqacaqacaqacaqadaqacaqacaqadaqacaqadaqadaqacaqadaqacaqa
caqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqaca
qacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacce3ibgaaamd
0uk5taaebawmebaugbggjcqolcwwmdq0odhesehqvfryxgbkahbwdhh8fisikjicokywumdayndu4otk8pt0+pz9aq
kndrudhsk5rulntvlhbw1xdzwzmaglpam9xc3r8fx+cgooehywgh4iiiymki4ynjo6plzawmpudnp+jpkwnqkmrrq+
xs7s0tbw2ulm6ury9v8hcwspfxsfjysvmzc7p0nht1nxw19na3d7f4ohj5oxm5+jq6+zt7u/w8vp09fb3+pn6+/z9/
gihbkwaaacvsurbvhjaxvvrqxvffp9bgeimkwlma5xuflncfacrcmguqifyipeskljqk9icfspcswsfmesim6+gfin
4qa2bzp+tpnb3zvbe2d2z2utzpu3doef8zt2zoxpomrlahejtcksbwjt7+4fgxob6eztbg0pzu+lxv1bszm37omglw
fbaznhpby9or+ganxxpvks8pxqa4dceuwmi0z0jg0opvqrkqifbv0twhrq+pwnskktjppsqww87bsjr6w0hgc84zyj
tuqzp8ikn7ztf7+loaayvq6tvbonouw/hdtlre3xu8qoo0sftdqvpcvbohlscuvbhhoyhxvhq+fv6gvrndfdmxnjxx
2rudk8eifrtuyspqaoa+t1fc9ykfhr1b02iqgil3u8m0hojpelmmqn8robop8jiybq26risj/e3ivkuwkwhsythw2u
sn/9strikgpxl1m6okviq3wirhshw6cpsayusrok1as4zvnksypbakj5vmcbqotnhvhdrrytcepqpyfjpli4sk1rbr
nujhd48aeeou0auepr/ll4v2asvt/axfgh8gzns92+mg2ekywf0rddxem302mqxqklfzjq+4zixwhlzj/irispnfoh
gz39qqzkfzsfklpwi6q1xzkqf6+5mhja236ud6/dheqn/fxrsfgaz/qbdtittbf3/jriqysqi46dtblmrop8phygnf
nq9vxyolzsjgnnaxft/cwokkbp/nwjaie7xvihha31x02nanm/peyes+hc0gdneywrleha8e2j8x4hpo0kalwq2zvb
vzrgce+dc5amrpbbsm31tu8mc39kvjjbnivnxgcf+wdxggiyxskmcv2zsmazju0alkkimdm7asi1yvshrdmkq6eegy
fxqv7bdgq0vbmiauzl8d4at/0wakdftnzl4rltgyywsqz5mx6cqu3jx7zlsem2jhl7hc2rljm1s/acjxp9chxqp++v
zkxyjobiv5atn9n0q4orzubr3uy0/zjdbn0wnbs4hjbsku0lyl364enme6vwqtbzfkoo0h5osrys8i3fwno3s+zep0
o/e8au5hhkkrjbfbct5r23+ufwmvfu+n3xeknzzroydmv+u2yted4927nue8ifyk+ozqd/rpp7olirtpsno49c94so
jvdsnyvr0uv9w7nydt2h96huv+acpoarbvwor8/daq7x/tdilpoqsfr/ldetd6j/7qf4/nvoajwvmgnofalhjqj0aa
mcowk9pq+ptphipbzbpslw6ghb5imj885q6pipnzkwatxyhaodmx6aox6jj0/cnfkc7oblibnazhuy2/6eypmlmbb4
dwcdz7e6rb1gkd1xx6b8ebojnwtoha7b+hed9+6yqpupm9ngaixsigydtdnfon02k+ciguumu+zgmaab20rtuzktq+
egzbxjraj4mibqavrtw+jilfcsyeqvomp07xokwhfztkao+yo5wnkdv/9qjyudycynhevjo8cu0wixkdehiy+zzj/j
omisv6pu/tciiy16vn3y0+kv60a9we1h63rm+qrx0y8j/vc+naguhvecj3i83hde5r0hp04qhfoikx9qnyof/xcz1a
1s7onrsa8nrlbtacrbwb4zb60tvb6hankwomow98xsnozijqub4obmz1ryriiuu5nri42eskqgrvlimwpzpf6fphyu
moiur/hlm4h/gc3/sx3uf8znlwdogyfepaxizsvt3irrabcsyivkgpvaaptywvl3qacykkwxkg/gbt2jaorjezhea8
zjhoyv/kxnlpk23vgszwitluokjh9+stvowcubbehoj1mwohzhkgy7mdjfakpqjj6cs/ifwpsjvadopsfcdlmmpchr
uga88w6stx1wnsktnogukr3zgewbpe78lvrvaiviiyfep8hhe/jsy7he2ikbei1skcsuhxqvp65odqj3gl1kjloke8
ie36imn0a0o+ifloofcjyv/sb3md2jaem+dpvtgodk9vcuid3xa+w4ut2mkltw6fauf8ygdlppyfbue4gk1s7m+jmf
3kzuj7gvke57vkhjlescni9rjcxxgxo+uex+xg7dh4bhl0yydd8z9lbdf5tlwtmwcn618po0argjjnskwjnocbdbyh
cghbbs2oxxgzw1zgecmaptto6eny92s+mcgh1msjzhtdhuxdlu3yd8ahmfmlkgcdowyhmemloy4qbutw6fn67d32nz
nqzchlv/2/xxglqfbfvna+/a9/gmm2o9w6d/eov0yj/6dtpqpcmk/zkb/oj/+a436j3rqp9sq/1iv/opn+o926z/cr
v94v/4ldvqveed7jrfov+aj/6ittf/1gv7lbtb+3q/qfuer0h7le9b+6rxqfu0xgo6lzwc0x/2eiq2x3wmf8pr/fzo
wq4z4gntdaaaaaelftksuqmcc height: height attribute not set width: width attribute not set description: adzocalo |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/los-andes-white.svg?d=2195 height: 28px width: 102px description: los andes white |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/chevron_up-white.svg?d=2195 height: 20px width: 16px description: menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/facebook-white.svg?d=2195 height: 24px width: 24px description: facebook los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/x-white.svg?d=2195 height: 24px width: 24px description: twitter los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/instagram-white.svg?d=2195 height: 24px width: 24px description: instagram los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/youtube-white.svg?d=2195 height: 24px width: 24px description: youtube los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/wyleex.svg?d=2195 height: 20px width: 95px description: wyleex |
How are images contributing to your SEO site-wise ? Your leading content tool has the awnsers!