www.losandes.com.ar website review
Improve your SEO :: free trial!
www.losandes.com.ar is 65% geoptimaliseerd!
SEO Keyword summary for www.losandes.com.ar/muy-tecno/cuidado-con-esta-estafa-de-whatsapp-que-promete-50-mil-a-cambio-de-calificar-un-hotel-en-google-maps/
Keywords are extracted from the main content of your website and are the primary indicator of the words this page could rank for. By frequenty count we expect your focus keyword to be que
Focus keyword
Short and long tail
Short Tail Keywords que una los |
long Tail Keywords (2 words) esta estafa con esta promete 50 un hotel que se |
long Tail Keywords (3 words) con esta estafa mil a cambio calificar un hotel hotel en google promete 50 mil cambio de calificar whatsapp que promete |
www.losandes.com.ar On-Page SEO Scan
Descriptive Elements
The <head> element of a www.losandes.com.ar/muy-tecno/cuidado-con-esta-estafa-de-whatsapp-que-promete-50-mil-a-cambio-de-calificar-un-hotel-en-google-maps/ page is used to inform the browser and visitors of the page about the general meta information. The head section of the page is where we place the page title, the definition of the HTML version used, the language of in which the page is written. In the head section we can also include JavaScript and CSS (markup) files for the page.
Page title
Title length
cuidado con esta estafa whatsapp que promete mil cambio calificar hotel google maps
Meta description
Meta description legth
Meta description SEO
varios usuarios argentinos les llegado una oferta trabajo online travs mensaje sin embargo especialistas ciberseguridad advierten que objetivo robar dinero datos personales cmo protegerse
Content SEO
Number of Words
Spam detected?
Headings
Heading distribution
Heading normalisation
Heading SEO impact
Emphasis (bold and italic)
Emphasis SEO impact
Images
Number of images
Images dimensions
Image alt descriptions
Images SEO impact
cerrar menu logo los andes facebook twitter instagram youtube claudio barros cuidado con esta estafa whatsapp que promete mil verificacin dos pasos llega por cambio calificar hotel google maps samsung lanz nuevos galaxy inteligencia artificial tiktok cul popular una intenta copiarse otra lanzaron gpt nuevo modelo audio texto visin renaper anses amenazas online nos acecharn gran hermano chile bizcochuelo esponjoso cuerpo mujer caimn tens uno estos apellidos comunes podras ser descendiente nobleza buen pastor lunes signo mala suerte hoy viral junio celebra nacional del perro venta ultra argentina cundo cobran las pensiones contributivas aguinaldo calendario tradicin cada noviembre voces suman femicidio cecilia strzyzowski marcela acua escribi carta compar cristo che guevara stfano hijo menor iliana calabr fabin rossi tragedia sebastin codina bandes subsecretaria legal capital humano leila gianni vocero presidencial manuel adorni mara laura belvedere apareci yaguaret corrientes navegante rosarino logr primer argentino cruzar atlntico vela cuarto adzocalo white wyleex
Mobile SEO www.losandes.com.ar/muy-tecno/cuidado-con-esta-estafa-de-whatsapp-que-promete-50-mil-a-cambio-de-calificar-un-hotel-en-google-maps/
Mobile rendering
Mobile optimizations
Responsive design detected (mobile css)
No flash detected !
Mobile improvement
Marketing / lead generation for www.losandes.com.ar/muy-tecno/cuidado-con-esta-estafa-de-whatsapp-que-promete-50-mil-a-cambio-de-calificar-un-hotel-en-google-maps/
Social Media
Facebook shares | Facebook likes | ||
Facebook comments | Tweets | ||
Google +1 |
Conversion form
Search form
Analytics
Online presence
SERP Preview
SERP Title
The title is trucated
SERP Link
SERP Description
Domain Level SEO
Domain name
19 characters long
Domain name SEO Impact
los found in domain name !
Path name
calificar found in path !
cambio found in path !
con found in path !
cuidado found in path !
est found in path !
esta found in path !
estafa found in path !
google found in path !
hotel found in path !
mil found in path !
promete found in path !
que found in path !
whatsapp found in path !
Structured data
Publisher Markup
Other Structured data
Website configuration
Correct processing of non-existing pages?
Favicon icon found?
HTML request without WWW redirected correctly?
Robots.txt found?
Sitemap found?
Navigation and internal links
Navigation
Url seperator
Human readable urls
Number of links
Link SEO Impact
ver promos de suscripcin
los andes
clasificados
auditorio
cmo anunciar
publicity
publicity
los andes san juan
|
autor claudio barros
nico nicolli
andrs aguilera
carla canizzaro
redaccin lavoz
redaccin los andes
roco sileci
oscar guilln
roco ledesma
maia had
lisandro tosello
|
economia cundo se cobran las pensiones no contributivas y el aguinaldo el calendario de junio
|
espectaculo qu pas con bigote el perro que form parte de gran hermano chile
gastn trezeguet pregunt quin se va de gran hermano 2024 y los resultados fueron muy contundentes
bautista pidi ayuda para desenmascarar a uno de sus compaeros de gran hermano
as est hoy stfano el hijo menor y perfil bajo de iliana calabr y fabin rossi
|
estilo chau bizcochuelo de cajita aprend a hacer uno casero fcil y barato para acompaar los mates de domingo
|
intent |
mundo encontraron el cuerpo de una mujer en la boca de un caimn en eeuu la vctima estaba desaparecida hace das
|
muy-tecno verificacin en dos pasos qu es cmo funciona y por qu ayuda a evitar robos online
samsung lanza sus telfonos galaxy s24 en argentina cunto cuestan y cmo obtener descuento de 250000
lanzaron gpt4o un nuevo modelo de inteligencia artificial con audio texto y visin cmo probarlo gratis
cre un truco para trollear a los estafadores de whatsapp cmo es y cmo usarlo paso a paso
filtracin de desnudos y tutoriales de ia para robar datos las amenazas online que nos acecharn en 2024
galaxy s24 ultra es ms barato en argentina que en chile y eeuu sacamos cuentas y este es el resultado
|
policiales a un ao del femicidio de cecilia strzyzowski marcela acua escribi una carta y se compar con cristo y el che guevara
mataron a una vecina por una campera y su hijo sali a escracharlos por las redes
ofrecen 3175000 de recompensa por el joven de guaymalln que lleva 1 ao y medio desaparecido
|
politica tiktok vs youtube cul es la plataforma ms popular y por qu una intenta parecerse a la otra
el gobierno de milei carg contra el juez casanello y dijo que hoy empieza a distribuir alimentos por vencer
|
por-las-redes si tens uno de estos 25 apellidos comunes podras ser descendiente de la nobleza
el evangelio de hoy 3 de junio la piedra que desecharon los constructores es la piedra angular
lunes 3 cul es el signo con ms mala suerte hoy
/una-influencer-argentina-visito-europa-y-se-sorprendio-por-el-precio-de-las-pastas-es-inentendible/
una influencer argentina visit europa y se sorprendi por el precio de las pastas es inentendible
2 de junio da nacional del perro por qu se celebra hoy
|
services cartelera de cine
cartelera de espectculos
|
sharer |
sociedad edicin impresa
alguien se haca pasar por un empleado de un reconocido supermercado y llamaba para regalar una orden de compra de 30 mil
/dia-mundial-de-la-contrasena-recomendaciones-para-elegir-una-contrasena-segura-y-facil-de-recordar/
da mundial de la contrasea recomendaciones para elegir una contrasea segura y fcil de recordar
denunciaron el hackeo de la base de datos del registro nacional de las personas pero el gobierno lo niega
furor por la inesperada oferta de una yerba top que lleg a los supermercados
|
sup-economia sustentabilidad prcticas que mejoran el ecosistema de negocios
|
temas podcast
contenido exclusivo
ciberseguridad
estafa
whatsapp
google maps
|
www.losandes.com.ar sociedad
poltica
economa
opinin
deportes
policiales
fincas
arquitectura
editorial
escribe al lector
espectculos
estilo
muy tecno
mundo club house
sociales
turismo
vecinos
receptorias
por las redes
|
Links to external pages
Outloing links
losandes2.mitiendanube.com
www.guarda14.com
www.guarda14.com
losandespass.com.ar
www.rumbosdigital.com
losandes2.mitiendanube.com
tintero.com.ar
eventos.losandespass.com.ar
www.facebook.com
www.youtube.com
viapais.com.ar
viapais.com.ar
viapais.com.ar
viapais.com.ar
viapais.com.ar
www.lavoz.com.ar
www.lavoz.com.ar
www.clarin.com
www.ole.com.ar
entremujeres.clarin.com
www.viapais.com.ar
www.tycsports.com
tn.com.ar
www.ciudad.com.ar
www.eltrecetv.com.ar
radiomitre.cienradios.com
la100.cienradios.com
ar.cienradios.com
www.wyleex.com
SEO Advice for www.losandes.com.ar
In this section we provide pointers on how you can to optimize your web page so it can be found more easily by search engines and how to make it rank higher by optimizing the content of the page itself. For each of the individual criteria the maximum score is 100%. A score below 70% is considered to be indication that the page is not complying with general SEO standards and should be evaluated and/or fixed. Not every factor is weighted the same and some are not as important as others. Relatively unimportant factors like meta keywords are not included in the overall score.
Item | Factor | Pointers | |
---|---|---|---|
PageTitle | 100% | Far too many sites lack a page title. A page title is the first thing that shows in the search results so always use the title element. | |
Title relevance | 100% | A title should reflect the contents of a site. This site has a 92 % match | |
Title Length | 50% | Limit your title to anywhere between 40 and 70 characters. Your title was 103 characters long | |
Meta Description | 100% | A meta description is the second element that shows in the search results so always use the meta description. | |
Meta description length | 50% | The meta description should be between 145 and 160 characters. This meta description is 223 characters long. | |
Meta description relevance | 52% | Meta Description should reflect the contents of a site. This site has a 28 % match | |
Number of internal links | 50% | Linking to internal pages makes pages easier to find for search engines. Try to keep the number of links on your page roughly below 100. There are 167 internal links on this page. | |
Folder structure | 100% | We found a folder structure in the links on your page. A good folder structure makes a site easier to navigate. We found 15 level 1 folders and 20 folders above or in the first level of navigation. | |
Headings | 25% | Headers should reflect the contents of a site. This site has a 11 % match | |
Links | 14% | Link anchors should to some degree reflect the contents of a site. This site has a 7 % match | |
Image alt tags | 45% | Image alt tags should to some degree reflect the contents of a site. This site has a 16 % match | |
Bold and italic | 54% | Bold and italic tags should reflect the contents of a site to some degree. This site has a 18 % match | |
Html ratio | 30% | Try to keep the html / text ratio as low as possible. More html means longer loading times. Layout should be handled in a serpate css file | |
Image descriptions | 88% | 88.333333333333 % of all images have been described via the "alt" attribute. Describing images with relevant text may lead to better results in the search engines. | |
Page errors | 100% | Pages with no errors display significantly faster on most browsers. We detected 0 errors and warnings | |
WordCount | 20% | An ideal page contains between 400 and 600 words.This page contains 1773 words | |
Server response time | 30% | A slow server slows down a website. This server responds 895.02% slower the average | |
Gzip Compression | 100% | This site uses Gzip compression to display faster | |
Keywords in Domainname | 100% | There are important keywords in your domain name | |
Keywords in domain path | 100% | There are important keywords in the domain path | |
Structured Data | 100% | Structured data makes it easier for search engines to index your website | |
Inline css | 0% | Do not use inline css declarations. Inline css will slow down the rendering of the website. We detected 36 inline style declarations ( <a style="color:green">) with a size of 1159 bytes | |
Excessive use of the same words | 100% | There is no indication that there are one or more keywords that are used excessively. | |
Frames or iframes | 20% | The use of (i)frames can lead to problems crawling your page. Wij found 1 frame(s) on your page | |
Flash | 100% | Perfect, we detected no flash objects on your page | |
Css | 100% | Perfect, we did not detect too many CSS files | |
Javascript | 30% | Wij detected too much (10) blocking JavaScript files. Try to combine or defer the loading of JavaScript files | |
Mobile Website | 100% | Perfect, we found a responsive design for mobile users | |
Most important heading | 100% | Perfect, we detected a correct use of the most important (h1) heading! | |
Normalized headings | 40% | We dit not font a normalized heading structure. A heading 2 (h2) for example should be followed by a heading of an equal level (h2), a child heading (h3) or even a aprent heading (h1). |
How would you like to have SEO advice for all your pages ?? Start your SEO Dashboard and optimize your website!
www.losandes.com.ar images and descriptions
54 images found at www.losandes.com.ar Images can improve the user experience for a website by making a pag visually appealing Images can also add extra keyword relevance to a webpage by using alt tags. Images can also slow down a website. If the width and height for a picture is not specified for a browser know in advance how large the image is. A browser must first load the picture and see before it knows how much space should be on the page. Upon reservation In the meantime, the browser can do little but wait. When the height and width for the plate are given in the HTML code, a browser just continues to build for a page while the images load in the background.
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/close_white.svg?d=2199 height: 14px width: 12px description: cerrar |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/menu.svg?d=2199 height: 20px width: 17px description: menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/search.svg?d=2199 height: 20px width: 18px description: no alt description found |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/los-andes-140.svg?d=2199 height: 40px width: 160px description: los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/close.svg?d=2199 height: 18px width: 18px description: cerrar menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/chevron_down.svg?d=2199 height: 14px width: 12px description: no alt description found |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/facebook.svg?d=2199 height: 24px width: 24px description: facebook los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/x.svg?d=2199 height: 24px width: 24px description: twitter los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/instagram.svg?d=2199 height: 24px width: 24px description: instagram los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/youtube.svg?d=2199 height: 24px width: 24px description: youtube los andes |
|
https://www.losandes.com.ar/resizer/jlubz2zadiar14dbhsbo_aolz1q=/100x100/smart/s3.amazonaws.com/arc-authors/grupoclarin/b8b3161f-1d86-44cf-a641-2e0cf51d7c62.png height: 100px width: 100px description: claudio barros |
|
https://www.losandes.com.ar/resizer/syno4hzczfdl4jhviwcalekunk8=/0x0:0x0/980x640/filters:quality(80):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/r2i7it3ofra6ze5qhn33ocg5re.jpg height: 640px width: 980px description: cuidado con esta estafa de whatsapp que promete $ 50 mil |
|
https://www.losandes.com.ar/resizer/hs9h9nkwsbeuu6atblsr1nuyd8k=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/77iqivqqdfabdpu6hx36ib7mve.jpg height: 173px width: 307px description: verificación en dos pasos |
|
https://www.losandes.com.ar/resizer/jt9fhniqxt9wc4eggytkmy8cwxs=/1023x871/smart/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/rd3x2twbbvdb3idc4dfk3gpuny.jpg height: 871px width: 1023px description: cuidado con esta estafa que llega por whatsapp y promete $ 50 mil a cambio de calificar un hotel en google maps |
|
https://www.losandes.com.ar/resizer/sygabb7iolcafusdfl4_oh1ogeq=/1023x682/smart/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/7yoph2ihfzhudgytdwbkfujgg4.jpg height: 682px width: 1023px description: cuidado con esta estafa que llega por whatsapp y promete $ 50 mil a cambio de calificar un hotel en google maps |
|
https://www.losandes.com.ar/resizer/bqa7cz5bcgxqx_yhs9cozcuwxue=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/4tk7ildwzfbthfmjlzuc3jsi5e.jpg height: 173px width: 307px description: samsung lanzó los nuevos galaxy s24 con inteligencia artificial |
|
https://www.losandes.com.ar/resizer/gowgxsgs-5v2jlyqyxhkgkn3c6y=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/axdpkr4cbfh4de3ideiv76b2hy.jpg height: 173px width: 307px description: tiktok vs. youtube: cuál es la más popular y por qué una intenta copiarse de la otra |
|
https://www.losandes.com.ar/resizer/ra-vepvyoppff6zk045ohuudhti=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/kfazpanumraypbh6kf5szssurq.jpg height: 173px width: 307px description: lanzaron gpt-4o, un nuevo modelo de inteligencia artificial con audio, texto y visión |
|
https://www.losandes.com.ar/resizer/yfo9gccau-99joi_jmjbbre76e0=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/gzrtgmtbha4gkmtbgm2demzugy.jpg height: 360px width: 640px description: no alt description found |
|
https://www.losandes.com.ar/resizer/3g4jx8_p0cbuutpsnamndopy110=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/mjlmi5avnza4lhp3fo2oogyi6u.jpeg height: 360px width: 640px description: renaper anses |
|
https://www.losandes.com.ar/resizer/es632m1adi95zbjcbqawv0yzw9y=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/mq3tqmbsgvrtcnrzgmzdmzleha.jpg height: 360px width: 640px description: no alt description found |
|
https://www.losandes.com.ar/resizer/hyt9tsz4rsfyzctkapjrnnqumji=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/rndw6x7caneppfizg5zkvonlgm.jpg height: 360px width: 640px description: amenazas online que nos acecharán en 2024 |
|
https://www.losandes.com.ar/resizer/sjb0cht8iw2k_86r1ptmdev2w9o=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/7eohfnuozje5lmojtyzmdvfka4.jpg height: 88px width: 156px description: gran hermano chile |
|
https://www.losandes.com.ar/resizer/sihwrj3yjv73azucvnmhvcuzrsg=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/lm5qgfzbhzhd7dzdoojieakqpi.png height: 88px width: 156px description: gran hermano |
|
https://www.losandes.com.ar/resizer/rruhwooex3grwqk6pc3qoc52hu8=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/afbs2dqajzbrfcfo6n6rpkqxhu.jpg height: 88px width: 156px description: bizcochuelo más esponjoso |
|
https://www.losandes.com.ar/resizer/19njl7awjwcsl75ut_mojz7yiec=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/3obgyjwnbrcubbzoiymteh62ja.jpg height: 88px width: 156px description: gran hermano |
|
https://www.losandes.com.ar/resizer/wptxewqjaxjjtcacbell8zktzji=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/3nhx4j22xfc27e3sljhn5zg434.jpg height: 88px width: 156px description: el cuerpo de una mujer en un caimán |
|
https://www.losandes.com.ar/resizer/r7oolnwzt96de7zzlbnonwmzefc=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/qqcfbecmsjft7ghcvw3mkvgyty.jpg height: 88px width: 156px description: si tenés uno de estos 25 apellidos comunes, podrías ser descendiente de la nobleza |
|
https://www.losandes.com.ar/resizer/r8qegciksw9kzvlhxst1a92bhpg=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/6hutbwmakjg6tppwrhjhjxbviu.jpg height: 88px width: 156px description: el buen pastor |
|
https://www.losandes.com.ar/resizer/cbf646dbitlklgfuyfxjqa4nnvk=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/te2gfcsbtnhv7lfpdfaqq7rrv4.jpg height: 88px width: 156px description: lunes 3: cuál es el signo con más mala suerte hoy |
|
https://www.losandes.com.ar/resizer/jceteqfbgkfrvqhkhp9ochfbxzw=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/iniac2uxdzes5ex3s4j4z3fe24.png height: 88px width: 156px description: viral en tiktok |
|
https://www.losandes.com.ar/resizer/ldaefvzqoxnixb2dnbqman9ibd0=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/3zxjtkt2ffhtjef5znc6fhy3ee.jpg height: 88px width: 156px description: por qué hoy 2 de junio se celebra el día nacional del perro |
|
https://www.losandes.com.ar/resizer/oepr7yct2ad76rezeakjykdbii0=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/spivqjtwezhibc3dorirjtcu6u.jpg height: 180px width: 360px description: samsung lanzó a la venta el nuevo galaxy s24 ultra en argentina |
|
https://www.losandes.com.ar/resizer/gqwmz1bmxbjabzmup4uq3-qbhii=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ixan3uux5jerfjdjy7fuy72tvy.jpg height: 180px width: 360px description: cuándo se cobran las pensiones no contributivas y el aguinaldo: el calendario de junio |
|
https://www.losandes.com.ar/resizer/larkipfkb2u5fauve858clt-bqa=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/qqcfbecmsjft7ghcvw3mkvgyty.jpg height: 180px width: 360px description: si tenés uno de estos 25 apellidos comunes, podrías ser descendiente de la nobleza |
|
https://www.losandes.com.ar/resizer/crvpufx4gqhhmjaldjk-umktmcg=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/tmiljpy4qzatvmehyys4pw6ftu.jpg height: 180px width: 360px description: por qué se celebra el día de la tradición cada 10 de noviembre |
|
https://www.losandes.com.ar/resizer/s8vgqdzassgmumml7fdbb8bg8di=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/44jvhsnsezck3ojzmvzspig3na.jpg height: 180px width: 320px description: voces que suman |
|
https://www.losandes.com.ar/resizer/ssv65vn-yk5-oukjcecjn-2odcu=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/mtjk5xtzknfirks5jjfkaknvdy.jpg height: 180px width: 320px description: a un año del femicidio de cecilia strzyzowski, marcela acuña escribió una carta y se comparó con cristo y el che guevara |
|
https://www.losandes.com.ar/resizer/qiqjnve2l-48qhpezbpeoiicam4=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/xlmsrycb5fc35nmlsl6hrl3mpq.jpg height: 180px width: 320px description: stéfano, el hijo menor de iliana calabró y fabián rossi |
|
https://www.losandes.com.ar/resizer/p0oxa95ierran313erdpgkmdp2u=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ybomrifaw5c6jhufalajmclmse.png height: 180px width: 320px description: tragedia |
|
https://www.losandes.com.ar/resizer/8vfk5dxzd3qmiwpwgwpouszwrnm=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/trswzw47mbewvbzya7a4okyc6i.jpg height: 180px width: 320px description: sebastián codina bandes |
|
https://www.losandes.com.ar/resizer/gdd3trbr6mzvajzg6myqw5iswm8=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/rhdt7qkifvf2dbktefrrzpguja.jpg height: 180px width: 320px description: la subsecretaria legal de capital humano, leila gianni, y el vocero presidencial manuel adorni |
|
https://www.losandes.com.ar/resizer/4pd-uuxhwfiwwuprsnceabjvjfa=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/c2jpyp4vh5garh2akpn2hq24dq.png height: 180px width: 360px description: maría laura belvedere |
|
https://www.losandes.com.ar/resizer/pkmm3bwg9ypos7m7qwmnadmlily=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/cf3r2dxtnfcv5legn37wit5si4.jpg height: 180px width: 360px description: apareció un nuevo yaguareté en corrientes. |
|
https://www.losandes.com.ar/resizer/wy1oaexjksg5acgpxbcsbgfart8=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/prbh4cujfzevtk7jo6k5y4q3vu.jpg height: 180px width: 360px description: el navegante rosarino que logró ser el primer argentino en cruzar el atlántico en vela. |
|
https://www.losandes.com.ar/resizer/p4yhfztqahwx892slhr608pmb1w=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/xfbbaqa2xbe2fcpyk3ab2ihyia.jpg height: 180px width: 360px description: río cuarto |
|
http://www.losandes.com.ar/data:image/png;base64,ivborw0kggoaaaansuheugaaaiaaaacacamaaad04jh5aaaaa3ncsvqicajb4u/
gaaaacxbiwxmaahycaab2hagnwnjqaaaagxrfwhrtb2z0d2fyzqb3d3cuaw5rc2nhcguub3jnm+48ggaaalhqtfrf/
///aaaaaqacaaaaaqacaaaaaqacaaaaaaaaaqacaqacaaaaaqacaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaqacaaa
aaaaaaqacaaaaaaaaaqacaaaaaaaaaqacaaaaaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaaaaaaaaaqacaaaaaaaaa
aaaaaaaaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaqacaqacaaaaaqacaaaaaaaaaqacaaaeaqacaaaeaqacaaaeaaa
eaqacaqacaaadaqacaaadaaadaqacaaadaaadaaadaqacaqacaqacaaadaaadaqacaqacaaacaqacaaacaaacaaaca
qacaaacaqacaaacaaacaqacagacaqacaqacaqacagacaqacagacaqacagacaqacagacagacagacagacagacaqacaga
cagacaqacaqacagacagacaqacagacagacagacagacagacaqacaqacagacagacaqacaqacaqabaqabaqabaqabaqaca
qabaqacaqabaqacaqabaqabaqacaqabaqabaqacaqacaqacaqadaqacaqacaqadaqacaqadaqadaqacaqadaqacaqa
caqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqaca
qacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacce3ibgaaamd
0uk5taaebawmebaugbggjcqolcwwmdq0odhesehqvfryxgbkahbwdhh8fisikjicokywumdayndu4otk8pt0+pz9aq
kndrudhsk5rulntvlhbw1xdzwzmaglpam9xc3r8fx+cgooehywgh4iiiymki4ynjo6plzawmpudnp+jpkwnqkmrrq+
xs7s0tbw2ulm6ury9v8hcwspfxsfjysvmzc7p0nht1nxw19na3d7f4ohj5oxm5+jq6+zt7u/w8vp09fb3+pn6+/z9/
gihbkwaaacvsurbvhjaxvvrqxvffp9bgeimkwlma5xuflncfacrcmguqifyipeskljqk9icfspcswsfmesim6+gfin
4qa2bzp+tpnb3zvbe2d2z2utzpu3doef8zt2zoxpomrlahejtcksbwjt7+4fgxob6eztbg0pzu+lxv1bszm37omglw
fbaznhpby9or+ganxxpvks8pxqa4dceuwmi0z0jg0opvqrkqifbv0twhrq+pwnskktjppsqww87bsjr6w0hgc84zyj
tuqzp8ikn7ztf7+loaayvq6tvbonouw/hdtlre3xu8qoo0sftdqvpcvbohlscuvbhhoyhxvhq+fv6gvrndfdmxnjxx
2rudk8eifrtuyspqaoa+t1fc9ykfhr1b02iqgil3u8m0hojpelmmqn8robop8jiybq26risj/e3ivkuwkwhsythw2u
sn/9strikgpxl1m6okviq3wirhshw6cpsayusrok1as4zvnksypbakj5vmcbqotnhvhdrrytcepqpyfjpli4sk1rbr
nujhd48aeeou0auepr/ll4v2asvt/axfgh8gzns92+mg2ekywf0rddxem302mqxqklfzjq+4zixwhlzj/irispnfoh
gz39qqzkfzsfklpwi6q1xzkqf6+5mhja236ud6/dheqn/fxrsfgaz/qbdtittbf3/jriqysqi46dtblmrop8phygnf
nq9vxyolzsjgnnaxft/cwokkbp/nwjaie7xvihha31x02nanm/peyes+hc0gdneywrleha8e2j8x4hpo0kalwq2zvb
vzrgce+dc5amrpbbsm31tu8mc39kvjjbnivnxgcf+wdxggiyxskmcv2zsmazju0alkkimdm7asi1yvshrdmkq6eegy
fxqv7bdgq0vbmiauzl8d4at/0wakdftnzl4rltgyywsqz5mx6cqu3jx7zlsem2jhl7hc2rljm1s/acjxp9chxqp++v
zkxyjobiv5atn9n0q4orzubr3uy0/zjdbn0wnbs4hjbsku0lyl364enme6vwqtbzfkoo0h5osrys8i3fwno3s+zep0
o/e8au5hhkkrjbfbct5r23+ufwmvfu+n3xeknzzroydmv+u2yted4927nue8ifyk+ozqd/rpp7olirtpsno49c94so
jvdsnyvr0uv9w7nydt2h96huv+acpoarbvwor8/daq7x/tdilpoqsfr/ldetd6j/7qf4/nvoajwvmgnofalhjqj0aa
mcowk9pq+ptphipbzbpslw6ghb5imj885q6pipnzkwatxyhaodmx6aox6jj0/cnfkc7oblibnazhuy2/6eypmlmbb4
dwcdz7e6rb1gkd1xx6b8ebojnwtoha7b+hed9+6yqpupm9ngaixsigydtdnfon02k+ciguumu+zgmaab20rtuzktq+
egzbxjraj4mibqavrtw+jilfcsyeqvomp07xokwhfztkao+yo5wnkdv/9qjyudycynhevjo8cu0wixkdehiy+zzj/j
omisv6pu/tciiy16vn3y0+kv60a9we1h63rm+qrx0y8j/vc+naguhvecj3i83hde5r0hp04qhfoikx9qnyof/xcz1a
1s7onrsa8nrlbtacrbwb4zb60tvb6hankwomow98xsnozijqub4obmz1ryriiuu5nri42eskqgrvlimwpzpf6fphyu
moiur/hlm4h/gc3/sx3uf8znlwdogyfepaxizsvt3irrabcsyivkgpvaaptywvl3qacykkwxkg/gbt2jaorjezhea8
zjhoyv/kxnlpk23vgszwitluokjh9+stvowcubbehoj1mwohzhkgy7mdjfakpqjj6cs/ifwpsjvadopsfcdlmmpchr
uga88w6stx1wnsktnogukr3zgewbpe78lvrvaiviiyfep8hhe/jsy7he2ikbei1skcsuhxqvp65odqj3gl1kjloke8
ie36imn0a0o+ifloofcjyv/sb3md2jaem+dpvtgodk9vcuid3xa+w4ut2mkltw6fauf8ygdlppyfbue4gk1s7m+jmf
3kzuj7gvke57vkhjlescni9rjcxxgxo+uex+xg7dh4bhl0yydd8z9lbdf5tlwtmwcn618po0argjjnskwjnocbdbyh
cghbbs2oxxgzw1zgecmaptto6eny92s+mcgh1msjzhtdhuxdlu3yd8ahmfmlkgcdowyhmemloy4qbutw6fn67d32nz
nqzchlv/2/xxglqfbfvna+/a9/gmm2o9w6d/eov0yj/6dtpqpcmk/zkb/oj/+a436j3rqp9sq/1iv/opn+o926z/cr
v94v/4ldvqveed7jrfov+aj/6ittf/1gv7lbtb+3q/qfuer0h7le9b+6rxqfu0xgo6lzwc0x/2eiq2x3wmf8pr/fzo
wq4z4gntdaaaaaelftksuqmcc height: height attribute not set width: width attribute not set description: adzocalo |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/los-andes-white.svg?d=2199 height: 28px width: 102px description: los andes white |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/chevron_up-white.svg?d=2199 height: 20px width: 16px description: menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/facebook-white.svg?d=2199 height: 24px width: 24px description: facebook los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/x-white.svg?d=2199 height: 24px width: 24px description: twitter los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/instagram-white.svg?d=2199 height: 24px width: 24px description: instagram los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/youtube-white.svg?d=2199 height: 24px width: 24px description: youtube los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/wyleex.svg?d=2199 height: 20px width: 95px description: wyleex |
How are images contributing to your SEO site-wise ? Your leading content tool has the awnsers!