www.losandes.com.ar website review
Improve your SEO :: free trial!
www.losandes.com.ar is 67% geoptimaliseerd!
SEO Keyword summary for www.losandes.com.ar/policiales/video-un-guardia-de-tren-mato-a-un-hombre-de-una-pina-y-sigue-libre/
Keywords are extracted from the main content of your website and are the primary indicator of the words this page could rank for. By frequenty count we expect your focus keyword to be que
Focus keyword
Short and long tail
Short Tail Keywords que una por |
long Tail Keywords (2 words) san martn y se que le el guardia y el |
long Tail Keywords (3 words) guardia de tren infiltrado reclamo poltico reclamo poltico y y el gran propuesta de casamiento poltico y el federal en mendoza |
www.losandes.com.ar On-Page SEO Scan
Descriptive Elements
The <head> element of a www.losandes.com.ar/policiales/video-un-guardia-de-tren-mato-a-un-hombre-de-una-pina-y-sigue-libre/ page is used to inform the browser and visitors of the page about the general meta information. The head section of the page is where we place the page title, the definition of the HTML version used, the language of in which the page is written. In the head section we can also include JavaScript and CSS (markup) files for the page.
Page title
Title length
video guardia tren matoacute hombre una pintildea sigue libre
Meta description
Meta description legth
Meta description SEO
hecho ocurri diciembre pasado villa lugano provincia buenos aires familia vctima insiste que culpable sea procesado por homicidio
Content SEO
Number of Words
Spam detected?
Headings
Heading distribution
Heading normalisation
Heading SEO impact
Emphasis (bold and italic)
Emphasis SEO impact
Images
Number of images
Images dimensions
Image alt descriptions
Images SEO impact
cerrar menu logo los andes facebook twitter instagram youtube redaccin momento que morinigo enfrent guardia rob una camioneta cargada paquetes mercado libre tenia aos era albail abuso sexual mujer dio brutal paliza hija san martn trgico accidente cost vida persona mxico quiso sacarse selfie captura video tren chile secuestraron casi toneladas hierro haban sido robadas las vas guaymalln foto ministerio seguridad justicia robo rieles material ferroviario cmo estn mendoza controla estado gentileza ferrotur andino gran hermano cencosud ofrece empleo cules son requisitos aplicar peinados cmodos para invierno marcos ginocchio jess buen pastor vitral inquietante prediccin astrloga sobre situacin del pas milei traicionando torta banana dulce leche lionel messi volver ante atlanta united reto visual cundo celebrarn premios fierro paro universidades robaron auto cabify fondos fmi argentina luis mara souza luci bourguet llano petri ernesto mancinelli director general desarrollo comunitario gobierno infraestructua territorial virgen valle catamarca nacional escritor conoc casa leopoldo lugones crdoba laura belvedere apareci nuevo yaguaret corrientes navegante rosarino logr ser primer argentino cruzar atlntico vela cuarto adzocalo white wyleex
Mobile SEO www.losandes.com.ar/policiales/video-un-guardia-de-tren-mato-a-un-hombre-de-una-pina-y-sigue-libre/
Mobile rendering
Mobile optimizations
Responsive design detected (mobile css)
No flash detected !
Mobile improvement
Marketing / lead generation for www.losandes.com.ar/policiales/video-un-guardia-de-tren-mato-a-un-hombre-de-una-pina-y-sigue-libre/
Social Media
Facebook shares | Facebook likes | ||
Facebook comments | Tweets | ||
Google +1 |
Conversion form
Search form
Analytics
Online presence
SERP Preview
SERP Title
The title is trucated
SERP Link
SERP Description
Domain Level SEO
Domain name
19 characters long
Domain name SEO Impact
los found in domain name !
san found in domain name !
Path name
guardia found in path !
hombre found in path !
mat found in path !
sigue found in path !
tren found in path !
una found in path !
Structured data
Publisher Markup
Other Structured data
Website configuration
Correct processing of non-existing pages?
Favicon icon found?
HTML request without WWW redirected correctly?
Robots.txt found?
Sitemap found?
Navigation and internal links
Navigation
Url seperator
Human readable urls
Number of links
Link SEO Impact
ver promos de suscripcin
los andes
clasificados
auditorio
cmo anunciar
publicity
publicity
|
autor redaccin los andes
rodrigo cuello
natalia vzquez mocayar
francisco moreno
ignacio de la rosa
fernanda verdeslago wozniak
gastn bustelo
martina funes
marta e castellino
roco ledesma
maia had
lisandro tosello
|
economia el fmi se prepara para desembolsar 800 millones de dlares para la argentina
|
empleos cencosud ofrece empleo cules son los requisitos y cmo aplicar
|
escribe-el-lector el ferrocarril y la alta montaa mendocina
|
espectaculo gastn trezeguet pregunt quin se va de gran hermano 2024 y los resultados no dejaron dudas
la encuesta que nunca se equivoca ya determin quin se va de gran hermano 2024
as es la lujosa casa en salta de marcos ginocchio vigente ganador de gran hermano
martn fierro federal en mendoza propuesta de casamiento infiltrado reclamo poltico y el gran ganador
el festejo
el paso de leopoldo lugones por mendoza
|
estilo adis pelo suelto estos son los 5 peinados ms cmodos y fciles para usar en invierno
|
intent |
policiales rob una camioneta cargada de paquetes pero la abandon en el acceso este porque se prendi fuego
se cerr la investigacin sobre un italiano acusado de haber abusado de una inglesa en un hostel de ciudad
la joven que fue escrachada golpeando a su hija de 4 aos en san martn est acusada de matar a su ex suegra
secuestraron casi 20 toneladas de hierro que haban sido robadas de las vas en guaymalln
amenazaron a un chofer en godoy cruz le robaron el auto y se fueron a un telo quedaron detenidos
|
politica las universidades nacionales denuncian falta de respuesta del gobierno y van al paro por 48 horas
el frente amplio mentado por petri ya muestra obstculos en mendoza
ernesto mancinelli la situacin social en mendoza va a empeorar
|
por-las-redes selfie mortal trat de sacarse una fotografa con un tren histrico y muri desnucada
el evangelio de hoy 9 de junio el que cumple la voluntad de dios se es mi hermano
la inquietante prediccin de una astrloga sobre la situacin del pas a milei lo estn traicionando
la receta menos pensada de la torta de banana y dulce de leche sin horno y en pocos minutos
segn la inteligencia artificial as se vera messi en la pobreza
qu ves primero el reto visual que revela si sos una persona extrovertida
|
services cartelera de cine
cartelera de espectculos
|
sharer |
sociedad edicin impresa
robo de rieles y material ferroviario cmo estn las vas de mendoza y cmo se controla su estado
amor y letras conoci a su esposa en la biblioteca san martn y 56 aos despus present su libro en el mismo lugar
|
temas podcast
contenido exclusivo
trenes
homicidio
|
www.losandes.com.ar sociedad
poltica
economa
opinin
deportes
policiales
fincas
arquitectura
editorial
escribe el lector
espectculos
estilo
muy tecno
mundo club house
sociales
turismo
vecinos
receptorias
por las redes
empleos
|
Links to external pages
Outloing links
losandes2.mitiendanube.com
www.guarda14.com
www.guarda14.com
losandespass.com.ar
www.rumbosdigital.com
losandes2.mitiendanube.com
tintero.com.ar
eventos.losandespass.com.ar
www.facebook.com
www.youtube.com
viapais.com.ar
viapais.com.ar
viapais.com.ar
viapais.com.ar
viapais.com.ar
www.lavoz.com.ar
www.lavoz.com.ar
www.wyleex.com
SEO Advice for www.losandes.com.ar
In this section we provide pointers on how you can to optimize your web page so it can be found more easily by search engines and how to make it rank higher by optimizing the content of the page itself. For each of the individual criteria the maximum score is 100%. A score below 70% is considered to be indication that the page is not complying with general SEO standards and should be evaluated and/or fixed. Not every factor is weighted the same and some are not as important as others. Relatively unimportant factors like meta keywords are not included in the overall score.
Item | Factor | Pointers | |
---|---|---|---|
PageTitle | 100% | Far too many sites lack a page title. A page title is the first thing that shows in the search results so always use the title element. | |
Title relevance | 73% | A title should reflect the contents of a site. This site has a 56 % match | |
Title Length | 70% | Limit your title to anywhere between 40 and 70 characters. Your title was 83 characters long | |
Meta Description | 100% | A meta description is the second element that shows in the search results so always use the meta description. | |
Meta description length | 95% | The meta description should be between 145 and 160 characters. This meta description is 164 characters long. | |
Meta description relevance | 31% | Meta Description should reflect the contents of a site. This site has a 17 % match | |
Number of internal links | 70% | Linking to internal pages makes pages easier to find for search engines. Try to keep the number of links on your page roughly below 100. There are 160 internal links on this page. | |
Folder structure | 100% | We found a folder structure in the links on your page. A good folder structure makes a site easier to navigate. We found 14 level 1 folders and 19 folders above or in the first level of navigation. | |
Headings | 18% | Headers should reflect the contents of a site. This site has a 8 % match | |
Links | 12% | Link anchors should to some degree reflect the contents of a site. This site has a 6 % match | |
Image alt tags | 25% | Image alt tags should to some degree reflect the contents of a site. This site has a 9 % match | |
Bold and italic | 60% | Bold and italic tags should reflect the contents of a site to some degree. This site has a 20 % match | |
Html ratio | 30% | Try to keep the html / text ratio as low as possible. More html means longer loading times. Layout should be handled in a serpate css file | |
Image descriptions | 91% | 91.379310344828 % of all images have been described via the "alt" attribute. Describing images with relevant text may lead to better results in the search engines. | |
Page errors | 100% | Pages with no errors display significantly faster on most browsers. We detected 0 errors and warnings | |
WordCount | 45% | An ideal page contains between 400 and 600 words.This page contains 1242 words | |
Server response time | 30% | A slow server slows down a website. This server responds 877.28% slower the average | |
Gzip Compression | 100% | This site uses Gzip compression to display faster | |
Keywords in Domainname | 100% | There are important keywords in your domain name | |
Keywords in domain path | 100% | There are important keywords in the domain path | |
Structured Data | 100% | Structured data makes it easier for search engines to index your website | |
Inline css | 0% | Do not use inline css declarations. Inline css will slow down the rendering of the website. We detected 36 inline style declarations ( <a style="color:green">) with a size of 1159 bytes | |
Excessive use of the same words | 100% | There is no indication that there are one or more keywords that are used excessively. | |
Frames or iframes | 20% | The use of (i)frames can lead to problems crawling your page. Wij found 1 frame(s) on your page | |
Flash | 100% | Perfect, we detected no flash objects on your page | |
Css | 100% | Perfect, we did not detect too many CSS files | |
Javascript | 30% | Wij detected too much (11) blocking JavaScript files. Try to combine or defer the loading of JavaScript files | |
Mobile Website | 100% | Perfect, we found a responsive design for mobile users | |
Most important heading | 100% | Perfect, we detected a correct use of the most important (h1) heading! | |
Normalized headings | 40% | We dit not font a normalized heading structure. A heading 2 (h2) for example should be followed by a heading of an equal level (h2), a child heading (h3) or even a aprent heading (h1). |
How would you like to have SEO advice for all your pages ?? Start your SEO Dashboard and optimize your website!
www.losandes.com.ar images and descriptions
52 images found at www.losandes.com.ar Images can improve the user experience for a website by making a pag visually appealing Images can also add extra keyword relevance to a webpage by using alt tags. Images can also slow down a website. If the width and height for a picture is not specified for a browser know in advance how large the image is. A browser must first load the picture and see before it knows how much space should be on the page. Upon reservation In the meantime, the browser can do little but wait. When the height and width for the plate are given in the HTML code, a browser just continues to build for a page while the images load in the background.
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/close_white.svg?d=2212 height: 14px width: 12px description: cerrar |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/menu.svg?d=2212 height: 20px width: 17px description: menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/search.svg?d=2212 height: 20px width: 18px description: no alt description found |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/los-andes-140.svg?d=2212 height: 40px width: 160px description: los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/close.svg?d=2212 height: 18px width: 18px description: cerrar menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/chevron_down.svg?d=2212 height: 14px width: 12px description: no alt description found |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/facebook.svg?d=2212 height: 24px width: 24px description: facebook los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/x.svg?d=2212 height: 24px width: 24px description: twitter los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/instagram.svg?d=2212 height: 24px width: 24px description: instagram los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/youtube.svg?d=2212 height: 24px width: 24px description: youtube los andes |
|
https://www.losandes.com.ar/resizer/iuuu8a0ax-b3sx72bzfj1fuyvuc=/100x100/smart/s3.amazonaws.com/arc-authors/grupoclarin/3aad59e0-be62-4f05-a88d-4c88db2281b2.png height: 100px width: 100px description: redacción los andes |
|
https://www.losandes.com.ar/resizer/bfktrbfykrhuvckkot8iluvkjmk=/0x0:0x0/980x640/filters:quality(80):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/xiuk64ioyrbzho4fyrji3r4vu4.png height: 640px width: 980px description: el momento en que morinigo se enfrentó al guardia. |
|
https://www.losandes.com.ar/resizer/hfxfdxlr9xbwexsialbstlhpfri=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/qehrpvu3dfcetizjackm36cut4.jpeg height: 173px width: 307px description: robó una camioneta cargada de paquetes de mercado libre |
|
https://www.losandes.com.ar/resizer/pbtzkqgkafwnnxgjagigq0mbv0g=/1023x1432/smart/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/jhujyiyeobbetar3ibmf4jki6a.jpeg height: 1432px width: 1023px description: morinigo tenia 46 años y era albañil. |
|
https://www.losandes.com.ar/resizer/r-wx9kzewmgfqaosudq-cjbivco=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/zc5ulornbjg2jhaexabxgy3354.jpg height: 173px width: 307px description: abuso sexual |
|
https://www.losandes.com.ar/resizer/evcad9vkvca5pxhf2g-ui5f_wp4=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/mroik2ng4vgozjfwhg2pbr542i.jpg height: 173px width: 307px description: mujer de 19 años le dio una brutal paliza a su hija de 4 años en san martín |
|
https://www.losandes.com.ar/resizer/6xasjpwgznqfxr6hnf_xhec5msy=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ncwjcsr4l5c7bkzfpc7rzwpgr4.jpg height: 360px width: 640px description: el trágico accidente que le costó la vida a una persona en méxico que quiso sacarse una selfie. (captura video) |
|
https://www.losandes.com.ar/resizer/ct8o5plcdz0dzubniuju8zlbutc=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/svko64ojq5bi7havrjtw6mngdu.jpg height: 360px width: 640px description: tren a chile |
|
https://www.losandes.com.ar/resizer/p7dof81_rucgx4tcso5pk-cj4qg=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/pg2iut2p5fa5hlnuwcv6ewmp6m.jpg height: 360px width: 640px description: secuestraron casi 20 toneladas de hierro que habían sido robadas de las vías en guaymallén. | foto: ministerio de seguridad y justicia |
|
https://www.losandes.com.ar/resizer/mhnb4uambjydcvxi5siaxef-qx8=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/oiex4r3eprcztczyizrt3gduwu.png height: 360px width: 640px description: robo de rieles y material ferroviario: cómo están las vías de mendoza y cómo se controla su estado. foto: gentileza ferrotur andino |
|
https://www.losandes.com.ar/resizer/vfz6bh_0codr1uyqjlpr6p5ruzu=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/tdww5cefvvgxbizijq4o23kgfi.png height: 88px width: 156px description: gran hermano |
|
https://www.losandes.com.ar/resizer/lmrsow6zgocjb-afhph6rpkau5c=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/procysdocvbgdhattrjyicpaey.jpg height: 88px width: 156px description: gran hermano |
|
https://www.losandes.com.ar/resizer/g2vwscx4ze5ushshxrzb_hybxge=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/bwixay65jfgu5fg7pyshuieiza.png height: 88px width: 156px description: cencosud ofrece empleo: cuáles son los requisitos y cómo aplicar |
|
https://www.losandes.com.ar/resizer/bo1jfeqbldpit_waxt3hzotn1je=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/dtvkybczwveizb43eql7s7koua.jpeg height: 88px width: 156px description: los 5 peinados más cómodos para el invierno |
|
https://www.losandes.com.ar/resizer/jetgph1ou-3h_tzz30cmh5ccjqw=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ougyq56nyfahha5a2rtuqh2qiu.jpg height: 88px width: 156px description: marcos ginocchio |
|
https://www.losandes.com.ar/resizer/jjyuujurcu2ivvxjtecmmzlwune=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/54xcuwx3uzhebdh4gdsg2bqraa.jpg height: 88px width: 156px description: jesús buen pastor vitral |
|
https://www.losandes.com.ar/resizer/-dwwvqabdhk_qvqa6y3xvlyjnqg=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/3277555emfdynn55oe5slzxpgq.png height: 88px width: 156px description: la inquietante predicción de una astróloga sobre la situación del país: “a milei lo están traicionando” |
|
https://www.losandes.com.ar/resizer/jbdz6yaokxra1hv90zvvr84bnxs=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/xkgy77e2gzhwjhnhui6a7np2pu.jpg height: 88px width: 156px description: torta de banana y dulce de leche |
|
https://www.losandes.com.ar/resizer/nbhfq75qfkjoi3ek_ynukdhmirk=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ilyow4gufrc2hivlvud647qcby.jpg height: 88px width: 156px description: lionel messi volverá ante el atlanta united |
|
https://www.losandes.com.ar/resizer/zukufsizk2wyz83qktoqhyqbqaq=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/23dronhmufd4hhwupofnygyoca.png height: 88px width: 156px description: reto visual |
|
https://www.losandes.com.ar/resizer/oz6uwwhwddqinr3biopri8kw8qo=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/jng2bukogbckbdtpcdxuwffphm.jpg height: 180px width: 360px description: ¿cuándo se celebrarán los premios martín fierro 2024? |
|
https://www.losandes.com.ar/resizer/66yyfa0moy3-tls4fs-xsmdthku=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/eizltwwgv5h4toqwhve6t5344i.jpg height: 180px width: 360px description: paro de universidades |
|
https://www.losandes.com.ar/resizer/w5iwcyd6fg_ikbedor8rikaujvq=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/jaoomxdkh5ak5hzs6k32clbpc4.jpg height: 180px width: 360px description: se robaron un auto de cabify |
|
https://www.losandes.com.ar/resizer/k4q1hyurwju_qx9xxp0ow_gvl7o=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/2eqdn4tonzcnnlwm75e7enwiba.jpg height: 180px width: 360px description: fondos del fmi para la argentina |
|
https://www.losandes.com.ar/resizer/kjib9hwltuxbf_ekcvzfcfqjume=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/jng2bukogbckbdtpcdxuwffphm.jpg height: 180px width: 320px description: ¿cuándo se celebrarán los premios martín fierro 2024? |
|
https://www.losandes.com.ar/resizer/4-gfae7be-fnbvxs5g5r_ln0dcg=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/dlrdmevmivehnnrxfto6wfuu64.png height: 180px width: 320px description: luis maría da souza y luci bourguet. foto: gentileza |
|
https://www.losandes.com.ar/resizer/lanmn6b7-kiqqddhb35qqauomc0=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/k25vgpc6jjcnrhxzn4bwubunam.jpg height: 180px width: 320px description: llano petri |
|
https://www.losandes.com.ar/resizer/d_ealtzws7nfomuhzlqtarynx0q=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/octsu3jg2zh2rgwuzwhobl5cgi.jpg height: 180px width: 320px description: ernesto mancinelli, director general de desarrollo comunitario del ministerio de gobierno, infraestructua y desarrollo territorial. |
|
https://www.losandes.com.ar/resizer/dffvsd-bykqnaxvififunfojlu8=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/w2dlcu2nbfei3a3gnjthiayt4m.jpg height: 180px width: 320px description: virgen del valle de catamarca |
|
https://www.losandes.com.ar/resizer/eqnv5_fahoaocflfcxknukhhrmi=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/lqyaqkisizerfa4t22vcm256sm.jpg height: 180px width: 320px description: día nacional del escritor: conocé la casa de leopoldo lugones en córdoba |
|
https://www.losandes.com.ar/resizer/4pd-uuxhwfiwwuprsnceabjvjfa=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/c2jpyp4vh5garh2akpn2hq24dq.png height: 180px width: 360px description: maría laura belvedere |
|
https://www.losandes.com.ar/resizer/pkmm3bwg9ypos7m7qwmnadmlily=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/cf3r2dxtnfcv5legn37wit5si4.jpg height: 180px width: 360px description: apareció un nuevo yaguareté en corrientes. |
|
https://www.losandes.com.ar/resizer/wy1oaexjksg5acgpxbcsbgfart8=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/prbh4cujfzevtk7jo6k5y4q3vu.jpg height: 180px width: 360px description: el navegante rosarino que logró ser el primer argentino en cruzar el atlántico en vela. |
|
https://www.losandes.com.ar/resizer/p4yhfztqahwx892slhr608pmb1w=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/xfbbaqa2xbe2fcpyk3ab2ihyia.jpg height: 180px width: 360px description: río cuarto |
|
http://www.losandes.com.ar/data:image/png;base64,ivborw0kggoaaaansuheugaaaiaaaacacamaaad04jh5aaaaa3ncsvqicajb4u/
gaaaacxbiwxmaahycaab2hagnwnjqaaaagxrfwhrtb2z0d2fyzqb3d3cuaw5rc2nhcguub3jnm+48ggaaalhqtfrf/
///aaaaaqacaaaaaqacaaaaaqacaaaaaaaaaqacaqacaaaaaqacaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaqacaaa
aaaaaaqacaaaaaaaaaqacaaaaaaaaaqacaaaaaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaaaaaaaaaqacaaaaaaaaa
aaaaaaaaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaqacaqacaaaaaqacaaaaaaaaaqacaaaeaqacaaaeaqacaaaeaaa
eaqacaqacaaadaqacaaadaaadaqacaaadaaadaaadaqacaqacaqacaaadaaadaqacaqacaaacaqacaaacaaacaaaca
qacaaacaqacaaacaaacaqacagacaqacaqacaqacagacaqacagacaqacagacaqacagacagacagacagacagacaqacaga
cagacaqacaqacagacagacaqacagacagacagacagacagacaqacaqacagacagacaqacaqacaqabaqabaqabaqabaqaca
qabaqacaqabaqacaqabaqabaqacaqabaqabaqacaqacaqacaqadaqacaqacaqadaqacaqadaqadaqacaqadaqacaqa
caqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqaca
qacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacce3ibgaaamd
0uk5taaebawmebaugbggjcqolcwwmdq0odhesehqvfryxgbkahbwdhh8fisikjicokywumdayndu4otk8pt0+pz9aq
kndrudhsk5rulntvlhbw1xdzwzmaglpam9xc3r8fx+cgooehywgh4iiiymki4ynjo6plzawmpudnp+jpkwnqkmrrq+
xs7s0tbw2ulm6ury9v8hcwspfxsfjysvmzc7p0nht1nxw19na3d7f4ohj5oxm5+jq6+zt7u/w8vp09fb3+pn6+/z9/
gihbkwaaacvsurbvhjaxvvrqxvffp9bgeimkwlma5xuflncfacrcmguqifyipeskljqk9icfspcswsfmesim6+gfin
4qa2bzp+tpnb3zvbe2d2z2utzpu3doef8zt2zoxpomrlahejtcksbwjt7+4fgxob6eztbg0pzu+lxv1bszm37omglw
fbaznhpby9or+ganxxpvks8pxqa4dceuwmi0z0jg0opvqrkqifbv0twhrq+pwnskktjppsqww87bsjr6w0hgc84zyj
tuqzp8ikn7ztf7+loaayvq6tvbonouw/hdtlre3xu8qoo0sftdqvpcvbohlscuvbhhoyhxvhq+fv6gvrndfdmxnjxx
2rudk8eifrtuyspqaoa+t1fc9ykfhr1b02iqgil3u8m0hojpelmmqn8robop8jiybq26risj/e3ivkuwkwhsythw2u
sn/9strikgpxl1m6okviq3wirhshw6cpsayusrok1as4zvnksypbakj5vmcbqotnhvhdrrytcepqpyfjpli4sk1rbr
nujhd48aeeou0auepr/ll4v2asvt/axfgh8gzns92+mg2ekywf0rddxem302mqxqklfzjq+4zixwhlzj/irispnfoh
gz39qqzkfzsfklpwi6q1xzkqf6+5mhja236ud6/dheqn/fxrsfgaz/qbdtittbf3/jriqysqi46dtblmrop8phygnf
nq9vxyolzsjgnnaxft/cwokkbp/nwjaie7xvihha31x02nanm/peyes+hc0gdneywrleha8e2j8x4hpo0kalwq2zvb
vzrgce+dc5amrpbbsm31tu8mc39kvjjbnivnxgcf+wdxggiyxskmcv2zsmazju0alkkimdm7asi1yvshrdmkq6eegy
fxqv7bdgq0vbmiauzl8d4at/0wakdftnzl4rltgyywsqz5mx6cqu3jx7zlsem2jhl7hc2rljm1s/acjxp9chxqp++v
zkxyjobiv5atn9n0q4orzubr3uy0/zjdbn0wnbs4hjbsku0lyl364enme6vwqtbzfkoo0h5osrys8i3fwno3s+zep0
o/e8au5hhkkrjbfbct5r23+ufwmvfu+n3xeknzzroydmv+u2yted4927nue8ifyk+ozqd/rpp7olirtpsno49c94so
jvdsnyvr0uv9w7nydt2h96huv+acpoarbvwor8/daq7x/tdilpoqsfr/ldetd6j/7qf4/nvoajwvmgnofalhjqj0aa
mcowk9pq+ptphipbzbpslw6ghb5imj885q6pipnzkwatxyhaodmx6aox6jj0/cnfkc7oblibnazhuy2/6eypmlmbb4
dwcdz7e6rb1gkd1xx6b8ebojnwtoha7b+hed9+6yqpupm9ngaixsigydtdnfon02k+ciguumu+zgmaab20rtuzktq+
egzbxjraj4mibqavrtw+jilfcsyeqvomp07xokwhfztkao+yo5wnkdv/9qjyudycynhevjo8cu0wixkdehiy+zzj/j
omisv6pu/tciiy16vn3y0+kv60a9we1h63rm+qrx0y8j/vc+naguhvecj3i83hde5r0hp04qhfoikx9qnyof/xcz1a
1s7onrsa8nrlbtacrbwb4zb60tvb6hankwomow98xsnozijqub4obmz1ryriiuu5nri42eskqgrvlimwpzpf6fphyu
moiur/hlm4h/gc3/sx3uf8znlwdogyfepaxizsvt3irrabcsyivkgpvaaptywvl3qacykkwxkg/gbt2jaorjezhea8
zjhoyv/kxnlpk23vgszwitluokjh9+stvowcubbehoj1mwohzhkgy7mdjfakpqjj6cs/ifwpsjvadopsfcdlmmpchr
uga88w6stx1wnsktnogukr3zgewbpe78lvrvaiviiyfep8hhe/jsy7he2ikbei1skcsuhxqvp65odqj3gl1kjloke8
ie36imn0a0o+ifloofcjyv/sb3md2jaem+dpvtgodk9vcuid3xa+w4ut2mkltw6fauf8ygdlppyfbue4gk1s7m+jmf
3kzuj7gvke57vkhjlescni9rjcxxgxo+uex+xg7dh4bhl0yydd8z9lbdf5tlwtmwcn618po0argjjnskwjnocbdbyh
cghbbs2oxxgzw1zgecmaptto6eny92s+mcgh1msjzhtdhuxdlu3yd8ahmfmlkgcdowyhmemloy4qbutw6fn67d32nz
nqzchlv/2/xxglqfbfvna+/a9/gmm2o9w6d/eov0yj/6dtpqpcmk/zkb/oj/+a436j3rqp9sq/1iv/opn+o926z/cr
v94v/4ldvqveed7jrfov+aj/6ittf/1gv7lbtb+3q/qfuer0h7le9b+6rxqfu0xgo6lzwc0x/2eiq2x3wmf8pr/fzo
wq4z4gntdaaaaaelftksuqmcc height: height attribute not set width: width attribute not set description: adzocalo |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/los-andes-white.svg?d=2212 height: 28px width: 102px description: los andes white |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/chevron_up-white.svg?d=2212 height: 20px width: 16px description: menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/facebook-white.svg?d=2212 height: 24px width: 24px description: facebook los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/x-white.svg?d=2212 height: 24px width: 24px description: twitter los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/instagram-white.svg?d=2212 height: 24px width: 24px description: instagram los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/youtube-white.svg?d=2212 height: 24px width: 24px description: youtube los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/wyleex.svg?d=2212 height: 20px width: 95px description: wyleex |
How are images contributing to your SEO site-wise ? Your leading content tool has the awnsers!