www.losandes.com.ar website review
Improve your SEO :: free trial!
www.losandes.com.ar is 66% geoptimaliseerd!
SEO Keyword summary for www.losandes.com.ar/politica/controvertida-frase-de-una-diputada-es-mi-deseo-que-en-el-mundo-haya-mas-personas-con-sindrome-de-down/
Keywords are extracted from the main content of your website and are the primary indicator of the words this page could rank for. By frequenty count we expect your focus keyword to be que
Focus keyword
Short and long tail
Short Tail Keywords que los del |
long Tail Keywords (2 words) los andeshace con sndrome personas con que se con el |
long Tail Keywords (3 words) personas con sndrome sndrome de down ms personas con partido conservador popular los andeshace 1 haya ms personas es mi deseo |
www.losandes.com.ar On-Page SEO Scan
Descriptive Elements
The <head> element of a www.losandes.com.ar/politica/controvertida-frase-de-una-diputada-es-mi-deseo-que-en-el-mundo-haya-mas-personas-con-sindrome-de-down/ page is used to inform the browser and visitors of the page about the general meta information. The head section of the page is where we place the page title, the definition of the HTML version used, the language of in which the page is written. In the head section we can also include JavaScript and CSS (markup) files for the page.
Page title
Title length
controvertida frase una diputada ldquoes deseo que mundo haya maacutes personas con siacutendrome downrdquo
Meta description
Meta description legth
Meta description SEO
gladys salinas diputada entrerriana expres deseo respuesta polmico posteo relacionado con gobernador chubut
Content SEO
Number of Words
Spam detected?
Headings
Heading distribution
Heading normalisation
Heading SEO impact
Emphasis (bold and italic)
Emphasis SEO impact
Images
Number of images
Images dimensions
Image alt descriptions
Images SEO impact
cerrar menu logo los andes facebook twitter instagram youtube redaccin gladys salinas representante del partido conservador popular entre ros sndrome down foto que gener polmica por like javier milei habl sobre ante asamblea legislativa abri las sesiones ordinarias congreso debate ley bases cmara diputados dip jorge rizzoti ucr jujuy sesion recinto comisiones paquete fiscal jubilados telekino cmo conseguir mercado pago emilia attias turco nam whirlpool recort turno produccin redujo menos empleos planta pilar galletas saborizadas cul signo zodaco engaa reto visual receta membrillitos sencillo paso para cocinar galletitas acompaar mate jess apostoles vitral descubren nuevo dinosaurio patagnico koleken inakayali mayo muerto varios heridos tras fuertes turbulencias vuelo londres singapur renovada avenida strassera sufre destrozos martn menem lourdes arrieta dos claves tens tener cuenta antes pedir crdito hipotecario uva supervielle camino peas maip municipio paulo dybala oriana sabatini cannes redes vaca muerta mara laura belvedere apareci yaguaret corrientes navegante rosarino logr ser primer argentino cruzar atlntico vela libros adzocalo white wyleex
Mobile SEO www.losandes.com.ar/politica/controvertida-frase-de-una-diputada-es-mi-deseo-que-en-el-mundo-haya-mas-personas-con-sindrome-de-down/
Mobile rendering
Mobile optimizations
Responsive design detected (mobile css)
No flash detected !
Mobile improvement
Marketing / lead generation for www.losandes.com.ar/politica/controvertida-frase-de-una-diputada-es-mi-deseo-que-en-el-mundo-haya-mas-personas-con-sindrome-de-down/
Social Media
Facebook shares | Facebook likes | ||
Facebook comments | Tweets | ||
Google +1 |
Conversion form
Search form
Analytics
Online presence
SERP Preview
SERP Title
The title is trucated
SERP Link
SERP Description
Domain Level SEO
Domain name
19 characters long
Domain name SEO Impact
los found in domain name !
Path name
con found in path !
deseo found in path !
diputada found in path !
down found in path !
haya found in path !
ndrome found in path !
persona found in path !
personas found in path !
pol found in path !
que found in path !
tica found in path !
una found in path !
Structured data
Publisher Markup
Other Structured data
Website configuration
Correct processing of non-existing pages?
Favicon icon found?
HTML request without WWW redirected correctly?
Robots.txt found?
Sitemap found?
Navigation and internal links
Navigation
Url seperator
Human readable urls
Number of links
Link SEO Impact
ver promos de suscripcin
los andes
clasificados
auditorio
cmo anunciar
publicity
publicity
los andes san juan
|
autor redaccin los andes
luna memoli
fernanda verdeslago wozniak
espacio de publicidad
roco ledesma
maia had
lisandro tosello
|
economia medio aguinaldo jubilados malas noticias para los que perciben la mnima
cunto hay que invertir en mercado pago para obtener una ganancia de 200 mil
una multinacional redujo un turno y recort personal en la planta que abri hace dos aos
dos claves que tens que tener en cuenta antes de pedir un crdito hipotecario uva
comenz la construccin de los primeros 130 kilmetros del oleoducto vaca muerta sur
|
espacio-de-marca supervielle apoya el desarrollo de la minera con soluciones 100 personalizadas para la industria
|
espectaculo /asi-es-la-casa-en-la-que-vivian-emilia-attias-y-el-turco-naim-estilo-antiguo-y-grandes-escalinatas/
as es la casa en la que vivan emilia attias y el turco nam estilo antiguo y grandes escalinatas
oriana sabatini y paulo dybala sorprendieron en el festival de cannes cmo vistieron
|
intent |
mundo un muerto y varios heridos tras fuertes turbulencias en un vuelo de londres a singapur
|
noticias-institucionales comienza una nueva edicin del camino de las peas
|
politica milei convoc a un acuerdo nacional pero puso condiciones y subi el nivel de confrontacin
de orga de gastos a jinetes del fracaso las contundentes frases de milei contra la oposicin en su discurso
discurso presidencial apoyo del macrismo algo de desconfianza en la ucr y oposicin del peronismo
la ucr pidi una sesin especial en diputados para tratar el presupuesto universitario
la grave denuncia de un diputado durante un streaming en vivo contra colegas estn untados por
el regreso de la ley bases a diputados seis preguntas y respuestas sobre qu puede pasar
ley bases se aleja el dictamen y la rosada ya afina la estrategia para el regreso a diputados
lourdes arrieta qued a un paso de quedarse con el sello de la libertad avanza en mendoza
|
por-las-redes una naranja y pocos ingredientes para hacer la receta de unas deliciosas galletitas
cul es el signo del zodaco al que mejor le sale engaar
qu ves primero el reto visual que revela si sos una persona terca
la receta de los membrillitos el sencillo paso a paso para cocinar las galletitas y acompaar el mate
el evangelio de hoy 21 de mayo si alguno quiere ser el primero que sea el ltimo de todos
|
services cartelera de cine
cartelera de espectculos
|
sharer |
sociedad edicin impresa
like del presidente a una publicacin
un mendocino gan ms de 260 millones en el telekino adems de un viaje a ro de janeiro un auto y una casa
el dinosaurio keloken nuevas especies de dinosaurios carnvoros fueron halladas en argentina
qu pasa con el feriado del 25 de mayo hay fin de semana xl
a menos de un ao de su inauguracin el boulevard strassera tiene ms de 50 bolardos rotos
|
temas podcast
contenido exclusivo
diputados
entre ros
sindrome de down
|
www.losandes.com.ar sociedad
poltica
economa
opinin
deportes
policiales
fincas
arquitectura
editorial
escribe al lector
espectculos
estilo
muy tecno
mundo club house
sociales
turismo
vecinos
receptorias
por las redes
|
Links to external pages
Outloing links
losandes2.mitiendanube.com
www.guarda14.com
www.guarda14.com
losandespass.com.ar
www.rumbosdigital.com
losandes2.mitiendanube.com
tintero.com.ar
eventos.losandespass.com.ar
www.facebook.com
www.youtube.com
viapais.com.ar
viapais.com.ar
viapais.com.ar
viapais.com.ar
viapais.com.ar
www.lavoz.com.ar
www.lavoz.com.ar
www.clarin.com
www.ole.com.ar
entremujeres.clarin.com
www.viapais.com.ar
www.tycsports.com
tn.com.ar
www.ciudad.com.ar
www.eltrecetv.com.ar
radiomitre.cienradios.com
la100.cienradios.com
ar.cienradios.com
www.wyleex.com
SEO Advice for www.losandes.com.ar
In this section we provide pointers on how you can to optimize your web page so it can be found more easily by search engines and how to make it rank higher by optimizing the content of the page itself. For each of the individual criteria the maximum score is 100%. A score below 70% is considered to be indication that the page is not complying with general SEO standards and should be evaluated and/or fixed. Not every factor is weighted the same and some are not as important as others. Relatively unimportant factors like meta keywords are not included in the overall score.
Item | Factor | Pointers | |
---|---|---|---|
PageTitle | 100% | Far too many sites lack a page title. A page title is the first thing that shows in the search results so always use the title element. | |
Title relevance | 65% | A title should reflect the contents of a site. This site has a 50 % match | |
Title Length | 50% | Limit your title to anywhere between 40 and 70 characters. Your title was 131 characters long | |
Meta Description | 100% | A meta description is the second element that shows in the search results so always use the meta description. | |
Meta description length | 85% | The meta description should be between 145 and 160 characters. This meta description is 134 characters long. | |
Meta description relevance | 97% | Meta Description should reflect the contents of a site. This site has a 54 % match | |
Number of internal links | 50% | Linking to internal pages makes pages easier to find for search engines. Try to keep the number of links on your page roughly below 100. There are 164 internal links on this page. | |
Folder structure | 100% | We found a folder structure in the links on your page. A good folder structure makes a site easier to navigate. We found 13 level 1 folders and 18 folders above or in the first level of navigation. | |
Headings | 21% | Headers should reflect the contents of a site. This site has a 9 % match | |
Links | 12% | Link anchors should to some degree reflect the contents of a site. This site has a 6 % match | |
Image alt tags | 34% | Image alt tags should to some degree reflect the contents of a site. This site has a 12 % match | |
Bold and italic | 100% | Bold and italic tags should reflect the contents of a site to some degree. This site has a 40 % match | |
Html ratio | 30% | Try to keep the html / text ratio as low as possible. More html means longer loading times. Layout should be handled in a serpate css file | |
Image descriptions | 91% | 91.379310344828 % of all images have been described via the "alt" attribute. Describing images with relevant text may lead to better results in the search engines. | |
Page errors | 100% | Pages with no errors display significantly faster on most browsers. We detected 0 errors and warnings | |
WordCount | 45% | An ideal page contains between 400 and 600 words.This page contains 1263 words | |
Server response time | 30% | A slow server slows down a website. This server responds 782.37% slower the average | |
Gzip Compression | 100% | This site uses Gzip compression to display faster | |
Keywords in Domainname | 100% | There are important keywords in your domain name | |
Keywords in domain path | 100% | There are important keywords in the domain path | |
Structured Data | 100% | Structured data makes it easier for search engines to index your website | |
Inline css | 0% | Do not use inline css declarations. Inline css will slow down the rendering of the website. We detected 36 inline style declarations ( <a style="color:green">) with a size of 1159 bytes | |
Excessive use of the same words | 100% | There is no indication that there are one or more keywords that are used excessively. | |
Frames or iframes | 20% | The use of (i)frames can lead to problems crawling your page. Wij found 1 frame(s) on your page | |
Flash | 100% | Perfect, we detected no flash objects on your page | |
Css | 100% | Perfect, we did not detect too many CSS files | |
Javascript | 30% | Wij detected too much (11) blocking JavaScript files. Try to combine or defer the loading of JavaScript files | |
Mobile Website | 100% | Perfect, we found a responsive design for mobile users | |
Most important heading | 100% | Perfect, we detected a correct use of the most important (h1) heading! | |
Normalized headings | 40% | We dit not font a normalized heading structure. A heading 2 (h2) for example should be followed by a heading of an equal level (h2), a child heading (h3) or even a aprent heading (h1). |
How would you like to have SEO advice for all your pages ?? Start your SEO Dashboard and optimize your website!
www.losandes.com.ar images and descriptions
52 images found at www.losandes.com.ar Images can improve the user experience for a website by making a pag visually appealing Images can also add extra keyword relevance to a webpage by using alt tags. Images can also slow down a website. If the width and height for a picture is not specified for a browser know in advance how large the image is. A browser must first load the picture and see before it knows how much space should be on the page. Upon reservation In the meantime, the browser can do little but wait. When the height and width for the plate are given in the HTML code, a browser just continues to build for a page while the images load in the background.
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/close_white.svg?d=2188 height: 14px width: 12px description: cerrar |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/menu.svg?d=2188 height: 20px width: 17px description: menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/search.svg?d=2188 height: 20px width: 18px description: no alt description found |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/los-andes-140.svg?d=2188 height: 40px width: 160px description: los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/close.svg?d=2188 height: 18px width: 18px description: cerrar menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/chevron_down.svg?d=2188 height: 14px width: 12px description: no alt description found |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/facebook.svg?d=2188 height: 24px width: 24px description: facebook los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/x.svg?d=2188 height: 24px width: 24px description: twitter los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/instagram.svg?d=2188 height: 24px width: 24px description: instagram los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/youtube.svg?d=2188 height: 24px width: 24px description: youtube los andes |
|
https://www.losandes.com.ar/resizer/iuuu8a0ax-b3sx72bzfj1fuyvuc=/100x100/smart/s3.amazonaws.com/arc-authors/grupoclarin/3aad59e0-be62-4f05-a88d-4c88db2281b2.png height: 100px width: 100px description: redacción los andes |
|
https://www.losandes.com.ar/resizer/gkvw5edr4tgl6wsmdtp-8sgbyek=/0x0:0x0/980x640/filters:quality(80):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/mymsshavuvbxhnmayw5jubqp2m.jpg height: 640px width: 980px description: gladys salinas, representante del partido conservador popular de entre ríos |
|
https://www.losandes.com.ar/resizer/fc1uths6etgod2x7s1lusawft_4=/1023x1217/smart/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/mwinzqrrkjchdpp4fabvseye6a.jpg height: 1217px width: 1023px description: síndrome de down: la foto en x que generó polémica por el like de javier milei |
|
https://www.losandes.com.ar/resizer/0r1w2_edbpgpymmveflqfkomxku=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/4n4cnbbl7ze5vebl2alizrpgmy.jpeg height: 173px width: 307px description: milei |
|
https://www.losandes.com.ar/resizer/ol8gjesu2dnbdjx6gxt3vj4t1mc=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/m77x7zkelbby5dqcx6wkr6lty4.png height: 173px width: 307px description: javier milei |
|
https://www.losandes.com.ar/resizer/mks_qsjncc2h0wexx0hkoykidve=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/avz2hwas3vhapbwcxxcq42b7ku.jpeg height: 173px width: 307px description: javier milei habló sobre ante la asamblea legislativa y abrió las sesiones ordinarias del congreso |
|
https://www.losandes.com.ar/resizer/tg9tjryewaz7x0fu3c4eqiu-1tq=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/h7z3kwbo5bh7fpvp5bdjomyeam.jpeg height: 360px width: 640px description: debate de la ley bases en la cámara de diputados |
|
https://www.losandes.com.ar/resizer/s76r-ng2dktazq86pp5sezp4mai=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/pmmszmlc3zhv7iuton6xjyxds4.jpg height: 360px width: 640px description: dip. jorge rizzoti (ucr- jujuy) |
|
https://www.losandes.com.ar/resizer/qw8fsze30oiixclkhaedwnib7kk=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/37wmpgelknbohnjxvupchsfpem.jpeg height: 360px width: 640px description: sesion diputados recinto |
|
https://www.losandes.com.ar/resizer/pheaf5jhrspasv5o7stju2-8vb4=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/bqcaqsby5rfivpapj6yknpx4du.jpg height: 360px width: 640px description: comisiones ley bases paquete fiscal |
|
https://www.losandes.com.ar/resizer/idw56ddoaeqipsft6h7fxuma0s0=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/tzcnmcs2yfck7nacgdwleds7ui.jpg height: 88px width: 156px description: jubilados |
|
https://www.losandes.com.ar/resizer/ipdgyybt5vtlygm1v1wwc96idka=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/qwe7nv3ccncifd7pi6s5isp3iu.jpg height: 88px width: 156px description: telekino |
|
https://www.losandes.com.ar/resizer/jquygeqa4v7oqd4xyxidhep7ofe=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/e3wx2rxd6fbfli5pmvbwxd3bcu.jpg height: 88px width: 156px description: cómo conseguir $200.000 en mercado pago. |
|
https://www.losandes.com.ar/resizer/vtsrqn0y0jgzb6ajdk0nqfrhwk0=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/aqnij6sierabrbzqbm3lanm2r4.jpg height: 88px width: 156px description: emilia attias y el turco naím |
|
https://www.losandes.com.ar/resizer/l21dc5txnj2n5kzcjodw4gmmu6a=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/3smtqx47tbecpoo6cu5pkry5wi.png height: 88px width: 156px description: whirlpool recortó un turno de la producción y redujo al menos 60 empleos en su planta de pilar |
|
https://www.losandes.com.ar/resizer/une_4ogbgg5tgfhanhhjhraywhg=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/e3dmjwfgv5ayfm5x7cfa3aoqye.jpg height: 88px width: 156px description: galletas saborizadas. |
|
https://www.losandes.com.ar/resizer/ssxq80tyzcqfn2fwrl1eflepjhm=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/j45ocgtlxfeqnaxobrcevewfcy.jpg height: 88px width: 156px description: cuál es el signo del zodíaco que más engaña |
|
https://www.losandes.com.ar/resizer/km6ncef68-hrouir2cal6zhgdvu=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/em6myzxev5aa5oqsc475zw4pta.jpg height: 88px width: 156px description: reto visual |
|
https://www.losandes.com.ar/resizer/ah_3erhf2jsxtcrw6dnrnvvb-7a=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/okuu5t6pcff33j7vabmg6xjquy.jpg height: 88px width: 156px description: la receta de los membrillitos: el sencillo paso a paso para cocinar las galletitas y acompañar el mate |
|
https://www.losandes.com.ar/resizer/1yqx9iksz63kvhpjjfjj2spagze=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/3jhuxl3vprg7tajwohvu6aycsq.jpg height: 88px width: 156px description: jesÚs apostoles vitral |
|
https://www.losandes.com.ar/resizer/30od7mh7fquz2vjflo1it9-t0ps=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/7uimopfz3rbspauzpd2o7ikgfm.png height: 180px width: 360px description: descubren un nuevo dinosaurio patagónico: koleken inakayali |
|
https://www.losandes.com.ar/resizer/caf8qqohqxr4wqrbvpnazgfe6ls=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/7ip3u6rjnvbpval3sxcse5wsk4.png height: 180px width: 360px description: 25 de mayo |
|
https://www.losandes.com.ar/resizer/ek5y6hcrrtjanj33p0iqjcc81hs=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/cmmwupdtbbedlde74escwbe4yu.jpg height: 180px width: 360px description: un muerto y varios heridos tras fuertes turbulencias en un vuelo de londres a singapur |
|
https://www.losandes.com.ar/resizer/abudhuzsexjvuvifxhet6o_9knu=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/2dzupwuibvh35opvdhluyct54e.jpeg height: 180px width: 360px description: la renovada avenida strassera ya sufre destrozos |
|
https://www.losandes.com.ar/resizer/x1k1ko5l90dnqqxkwbmixbxk-3a=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/lwn7c2xt75efphgkoxleo37lou.jpg height: 180px width: 320px description: martín menem lourdes arrieta |
|
https://www.losandes.com.ar/resizer/0vajyknwsvssqkmyjoeorgvomss=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/4npmlm5n5baypatkroesrfqmqq.jpg height: 180px width: 320px description: dos claves que tenés que tener en cuenta antes de pedir un crédito hipotecario uva |
|
https://www.losandes.com.ar/resizer/i_cowl9wwzhqxtv6mkfj4xxr1lu=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/7jceo7c7wvefljqblvl73vugam.jpeg height: 180px width: 320px description: supervielle |
|
https://www.losandes.com.ar/resizer/xsezpxkv9ljsiyu8iqqpsxrhe2m=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/cwqco4rteza6limm5jyn4zhbfq.jpeg height: 180px width: 320px description: “camino de las peñas” en maipú. foto: maipú municipio. |
|
https://www.losandes.com.ar/resizer/bnhage6g6hhmids7l6kqj5_uzlg=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/nhm5zikacveldnkfxdw7mrqugu.png height: 180px width: 320px description: paulo dybala y oriana sabatini en cannes 2024. / redes |
|
https://www.losandes.com.ar/resizer/sszwhsjigmpx5mlivj8ez7prxlc=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ggizsgzxr5d5rm7mopvzfhvx6q.jpg height: 180px width: 320px description: vaca muerta. |
|
https://www.losandes.com.ar/resizer/4pd-uuxhwfiwwuprsnceabjvjfa=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/c2jpyp4vh5garh2akpn2hq24dq.png height: 180px width: 360px description: maría laura belvedere |
|
https://www.losandes.com.ar/resizer/pkmm3bwg9ypos7m7qwmnadmlily=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/cf3r2dxtnfcv5legn37wit5si4.jpg height: 180px width: 360px description: apareció un nuevo yaguareté en corrientes. |
|
https://www.losandes.com.ar/resizer/wy1oaexjksg5acgpxbcsbgfart8=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/prbh4cujfzevtk7jo6k5y4q3vu.jpg height: 180px width: 360px description: el navegante rosarino que logró ser el primer argentino en cruzar el atlántico en vela. |
|
https://www.losandes.com.ar/resizer/3esdqmtvzau3kl6kznr7jtjfsoy=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/5hzo7u3zk5a25iodimjtabmhoi.jpg height: 180px width: 360px description: libros |
|
http://www.losandes.com.ar/data:image/png;base64,ivborw0kggoaaaansuheugaaaiaaaacacamaaad04jh5aaaaa3ncsvqicajb4u/
gaaaacxbiwxmaahycaab2hagnwnjqaaaagxrfwhrtb2z0d2fyzqb3d3cuaw5rc2nhcguub3jnm+48ggaaalhqtfrf/
///aaaaaqacaaaaaqacaaaaaqacaaaaaaaaaqacaqacaaaaaqacaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaqacaaa
aaaaaaqacaaaaaaaaaqacaaaaaaaaaqacaaaaaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaaaaaaaaaqacaaaaaaaaa
aaaaaaaaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaqacaqacaaaaaqacaaaaaaaaaqacaaaeaqacaaaeaqacaaaeaaa
eaqacaqacaaadaqacaaadaaadaqacaaadaaadaaadaqacaqacaqacaaadaaadaqacaqacaaacaqacaaacaaacaaaca
qacaaacaqacaaacaaacaqacagacaqacaqacaqacagacaqacagacaqacagacaqacagacagacagacagacagacaqacaga
cagacaqacaqacagacagacaqacagacagacagacagacagacaqacaqacagacagacaqacaqacaqabaqabaqabaqabaqaca
qabaqacaqabaqacaqabaqabaqacaqabaqabaqacaqacaqacaqadaqacaqacaqadaqacaqadaqadaqacaqadaqacaqa
caqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqaca
qacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacce3ibgaaamd
0uk5taaebawmebaugbggjcqolcwwmdq0odhesehqvfryxgbkahbwdhh8fisikjicokywumdayndu4otk8pt0+pz9aq
kndrudhsk5rulntvlhbw1xdzwzmaglpam9xc3r8fx+cgooehywgh4iiiymki4ynjo6plzawmpudnp+jpkwnqkmrrq+
xs7s0tbw2ulm6ury9v8hcwspfxsfjysvmzc7p0nht1nxw19na3d7f4ohj5oxm5+jq6+zt7u/w8vp09fb3+pn6+/z9/
gihbkwaaacvsurbvhjaxvvrqxvffp9bgeimkwlma5xuflncfacrcmguqifyipeskljqk9icfspcswsfmesim6+gfin
4qa2bzp+tpnb3zvbe2d2z2utzpu3doef8zt2zoxpomrlahejtcksbwjt7+4fgxob6eztbg0pzu+lxv1bszm37omglw
fbaznhpby9or+ganxxpvks8pxqa4dceuwmi0z0jg0opvqrkqifbv0twhrq+pwnskktjppsqww87bsjr6w0hgc84zyj
tuqzp8ikn7ztf7+loaayvq6tvbonouw/hdtlre3xu8qoo0sftdqvpcvbohlscuvbhhoyhxvhq+fv6gvrndfdmxnjxx
2rudk8eifrtuyspqaoa+t1fc9ykfhr1b02iqgil3u8m0hojpelmmqn8robop8jiybq26risj/e3ivkuwkwhsythw2u
sn/9strikgpxl1m6okviq3wirhshw6cpsayusrok1as4zvnksypbakj5vmcbqotnhvhdrrytcepqpyfjpli4sk1rbr
nujhd48aeeou0auepr/ll4v2asvt/axfgh8gzns92+mg2ekywf0rddxem302mqxqklfzjq+4zixwhlzj/irispnfoh
gz39qqzkfzsfklpwi6q1xzkqf6+5mhja236ud6/dheqn/fxrsfgaz/qbdtittbf3/jriqysqi46dtblmrop8phygnf
nq9vxyolzsjgnnaxft/cwokkbp/nwjaie7xvihha31x02nanm/peyes+hc0gdneywrleha8e2j8x4hpo0kalwq2zvb
vzrgce+dc5amrpbbsm31tu8mc39kvjjbnivnxgcf+wdxggiyxskmcv2zsmazju0alkkimdm7asi1yvshrdmkq6eegy
fxqv7bdgq0vbmiauzl8d4at/0wakdftnzl4rltgyywsqz5mx6cqu3jx7zlsem2jhl7hc2rljm1s/acjxp9chxqp++v
zkxyjobiv5atn9n0q4orzubr3uy0/zjdbn0wnbs4hjbsku0lyl364enme6vwqtbzfkoo0h5osrys8i3fwno3s+zep0
o/e8au5hhkkrjbfbct5r23+ufwmvfu+n3xeknzzroydmv+u2yted4927nue8ifyk+ozqd/rpp7olirtpsno49c94so
jvdsnyvr0uv9w7nydt2h96huv+acpoarbvwor8/daq7x/tdilpoqsfr/ldetd6j/7qf4/nvoajwvmgnofalhjqj0aa
mcowk9pq+ptphipbzbpslw6ghb5imj885q6pipnzkwatxyhaodmx6aox6jj0/cnfkc7oblibnazhuy2/6eypmlmbb4
dwcdz7e6rb1gkd1xx6b8ebojnwtoha7b+hed9+6yqpupm9ngaixsigydtdnfon02k+ciguumu+zgmaab20rtuzktq+
egzbxjraj4mibqavrtw+jilfcsyeqvomp07xokwhfztkao+yo5wnkdv/9qjyudycynhevjo8cu0wixkdehiy+zzj/j
omisv6pu/tciiy16vn3y0+kv60a9we1h63rm+qrx0y8j/vc+naguhvecj3i83hde5r0hp04qhfoikx9qnyof/xcz1a
1s7onrsa8nrlbtacrbwb4zb60tvb6hankwomow98xsnozijqub4obmz1ryriiuu5nri42eskqgrvlimwpzpf6fphyu
moiur/hlm4h/gc3/sx3uf8znlwdogyfepaxizsvt3irrabcsyivkgpvaaptywvl3qacykkwxkg/gbt2jaorjezhea8
zjhoyv/kxnlpk23vgszwitluokjh9+stvowcubbehoj1mwohzhkgy7mdjfakpqjj6cs/ifwpsjvadopsfcdlmmpchr
uga88w6stx1wnsktnogukr3zgewbpe78lvrvaiviiyfep8hhe/jsy7he2ikbei1skcsuhxqvp65odqj3gl1kjloke8
ie36imn0a0o+ifloofcjyv/sb3md2jaem+dpvtgodk9vcuid3xa+w4ut2mkltw6fauf8ygdlppyfbue4gk1s7m+jmf
3kzuj7gvke57vkhjlescni9rjcxxgxo+uex+xg7dh4bhl0yydd8z9lbdf5tlwtmwcn618po0argjjnskwjnocbdbyh
cghbbs2oxxgzw1zgecmaptto6eny92s+mcgh1msjzhtdhuxdlu3yd8ahmfmlkgcdowyhmemloy4qbutw6fn67d32nz
nqzchlv/2/xxglqfbfvna+/a9/gmm2o9w6d/eov0yj/6dtpqpcmk/zkb/oj/+a436j3rqp9sq/1iv/opn+o926z/cr
v94v/4ldvqveed7jrfov+aj/6ittf/1gv7lbtb+3q/qfuer0h7le9b+6rxqfu0xgo6lzwc0x/2eiq2x3wmf8pr/fzo
wq4z4gntdaaaaaelftksuqmcc height: height attribute not set width: width attribute not set description: adzocalo |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/los-andes-white.svg?d=2188 height: 28px width: 102px description: los andes white |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/chevron_up-white.svg?d=2188 height: 20px width: 16px description: menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/facebook-white.svg?d=2188 height: 24px width: 24px description: facebook los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/x-white.svg?d=2188 height: 24px width: 24px description: twitter los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/instagram-white.svg?d=2188 height: 24px width: 24px description: instagram los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/youtube-white.svg?d=2188 height: 24px width: 24px description: youtube los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/wyleex.svg?d=2188 height: 20px width: 95px description: wyleex |
How are images contributing to your SEO site-wise ? Your leading content tool has the awnsers!