www.losandes.com.ar website review
Improve your SEO :: free trial!
www.losandes.com.ar is 65% geoptimaliseerd!
SEO Keyword summary for www.losandes.com.ar/politica/la-rectora-de-la-uncuyo-respondio-a-las-propuestas-de-milei-la-educacion-no-es-un-bien-transable/
Keywords are extracted from the main content of your website and are the primary indicator of the words this page could rank for. By frequenty count we expect your focus keyword to be que
Focus keyword
Short and long tail
Short Tail Keywords que los las |
long Tail Keywords (2 words) los andeshace es un no es un bien lo que |
long Tail Keywords (3 words) no es un educacin no es es un bien propuestas de milei que la educacin que es muy candidato a presidente |
www.losandes.com.ar On-Page SEO Scan
Descriptive Elements
The <head> element of a www.losandes.com.ar/politica/la-rectora-de-la-uncuyo-respondio-a-las-propuestas-de-milei-la-educacion-no-es-un-bien-transable/ page is used to inform the browser and visitors of the page about the general meta information. The head section of the page is where we place the page title, the definition of the HTML version used, the language of in which the page is written. In the head section we can also include JavaScript and CSS (markup) files for the page.
Page title
Title length
rectora uncuyo respondioacute las propuestas milei ldquola educacioacuten bien transablerdquo
Meta description
Meta description legth
Meta description SEO
esther snchez manifest naturalmente contra idea que tiene candidato presidente libertario sea con privatizacin del conicet sistema vouchers pretende para educacin pblica
Content SEO
Number of Words
Spam detected?
Headings
Heading distribution
Heading normalisation
Heading SEO impact
Emphasis (bold and italic)
Emphasis SEO impact
Images
Number of images
Images dimensions
Image alt descriptions
Images SEO impact
cerrar menu logo los andes facebook twitter instagram youtube juan manuel torrez esther snchez rectora uncuyo foto ignacio blanco javier milei dijo que privatizar conicet caso ser electo presidente fue plan bonex por massa acus querer implementarlo javiermilei luis petri paso candidato votado argentina trasladaron madre lucio dupuy vuelve parque central una las expos diseadores importante mendoza sportotal fro cdula azul billetera virtual voucher educativo cubiertas pirelli vouchers educativos basura pan montaa rusa estudiante universidad cara desvel rumor facultad sorprendi todos mdica neg ceder asiento primera clase para nio viaje con familia arm polmica tostadoras estamos todas podcast investigacin clave valle uco buscan resolver conflicto entre productores ganaderos carnvoros nativos regresaron hbitat aves haban sido rescatadas cautiverio luego rehabilitarlas prensa ministerio ambiente energa tenso cruce marra grabois residencias mdicas empleados judiciales norma abate mazzucchelli antonio masterchef emocion sus fans tiktok ulpiano suarez visit trabajos realizados pasaje lirios mara laura belvedere apareci nuevo yaguaret corrientes navegante rosarino logr primer argentino cruzar atlntico vela hroes heronas cotidianos adzocalo white wyleex
Mobile SEO www.losandes.com.ar/politica/la-rectora-de-la-uncuyo-respondio-a-las-propuestas-de-milei-la-educacion-no-es-un-bien-transable/
Mobile rendering
Mobile optimizations
Responsive design detected (mobile css)
No flash detected !
Mobile improvement
Marketing / lead generation for www.losandes.com.ar/politica/la-rectora-de-la-uncuyo-respondio-a-las-propuestas-de-milei-la-educacion-no-es-un-bien-transable/
Social Media
Facebook shares | Facebook likes | ||
Facebook comments | Tweets | ||
Google +1 |
Conversion form
Search form
Analytics
Online presence
SERP Preview
SERP Title
The title is trucated
SERP Link
SERP Description
Domain Level SEO
Domain name
19 characters long
Domain name SEO Impact
los found in domain name !
Path name
bien found in path !
educaci found in path !
est found in path !
las found in path !
milei found in path !
pol found in path !
propuestas found in path !
rectora found in path !
transable found in path !
uncuyo found in path !
Structured data
Publisher Markup
Other Structured data
Website configuration
Correct processing of non-existing pages?
Favicon icon found?
HTML request without WWW redirected correctly?
Robots.txt found?
Sitemap found?
Navigation and internal links
Navigation
Url seperator
Human readable urls
Number of links
Link SEO Impact
ver promos de suscripcin
los andes
clasificados
auditorio
cmo anunciar
publicity
publicity
los andes san juan
|
autor juan manuel torrez
redaccin los andes
ignacio de la rosa
juan carlos albornoz
fernanda verdeslago wozniak
roco ledesma
maia had
lisandro tosello
|
brand-content-home hot sale 2024 una empresa cuyana se posiciona como lder en su categora
|
economia cunto hay que invertir para ganar un sueldo de 200000 en mercado pago
el gobierno de milei confirm que no habr ms voucher educativo cmo quedan las cuotas de las escuelas
sorpresa por los precios en chile cunto sale una cubierta
vouchers educativos cmo saber si la solicitud fue aprobada y cundo se cobran
|
espectaculo antonio de masterchef recibi una increble propuesta laboral ser un gran desafo
|
intent |
policiales video as trasladaron a la madre de lucio dupuy a un penal en mendoza tras pedir que la separaran de su pareja
|
politica milei prometi privatizar el conicet y dijo qu ministerios eliminar qu productividad tienen
qu opina milei sobre el sistema educativo y qu son los vouchers para estudiar
una candidata de milei en mendoza se mostr en contra de privatizar el conicet
qu fue el plan bonex y por qu massa acus a milei de querer implementarlo
cerruti sali a pulverizar las propuestas de milei son imposibles de llevar adelante seran la ruina de argentina
petri dijo que el conicet no se toca y se diferenci de javier milei
juan grabois y ramiro marra casi terminan a las pias en vivo manito blandita y yo no le robo a los pobres
creci mucho el inters por las residencias mdicas cunto cobrarn quienes pasen el examen
el plan del gobierno ante el reclamo de empleados y funcionarios judiciales
renunci una jueza de la rioja acusada de pedir una coima de 8 millones de pesos por una sucesin
|
por-las-redes el impresionante y nada repugnante significado de soar con basura
la receta sper fcil y econmica que es furor en redes sociales pan montaa rusa sin gluten
un estudiante revel el secreto mejor guardado de la universidad ms cara de argentina y el video es viral
una mdica se neg a ceder su asiento de primera clase para que un nio viaje con su familia y arm la polmica
este es el novedoso modo para que tu tostadora quede impecable tras varios aos de uso
|
services cartelera de cine
cartelera de espectculos
|
sharer |
sociedad edicin impresa
vuelve al parque central una de las expos de diseadores ms importante de mendoza
tiempo en mendoza mnimas glidas pero suben las mximas cmo estar el fin de semana
sin cdula azul cmo hay que hacer para autorizar a un tercero a manejar tu auto
esther snchez en estamos todas hay que adaptar la oferta acadmica al estudiante de hoy
volvan de tomar mates en la montaa y filmaron a un puma comiendo a un guanaco cmo actuar en estos casos
regresaron a su hbitat a 21 aves que haban sido rescatadas en cautiverio y luego de rehabilitarlas
ulpiano suarez visit los trabajos realizados en el pasaje los lirios
|
temas podcast
contenido exclusivo
mendoza
conicet
unc
|
www.losandes.com.ar sociedad
poltica
economa
opinin
deportes
policiales
fincas
arquitectura
editorial
escribe al lector
espectculos
estilo
muy tecno
mundo club house
sociales
turismo
vecinos
receptorias
content lab
por las redes
|
Links to external pages
Outloing links
losandes2.mitiendanube.com
www.guarda14.com
www.guarda14.com
losandespass.com.ar
www.rumbosdigital.com
losandes2.mitiendanube.com
tintero.com.ar
eventos.losandespass.com.ar
www.facebook.com
www.youtube.com
viapais.com.ar
viapais.com.ar
viapais.com.ar
viapais.com.ar
viapais.com.ar
www.lavoz.com.ar
www.lavoz.com.ar
www.clarin.com
www.ole.com.ar
entremujeres.clarin.com
www.viapais.com.ar
www.tycsports.com
tn.com.ar
www.ciudad.com.ar
www.eltrecetv.com.ar
radiomitre.cienradios.com
la100.cienradios.com
ar.cienradios.com
www.wyleex.com
SEO Advice for www.losandes.com.ar
In this section we provide pointers on how you can to optimize your web page so it can be found more easily by search engines and how to make it rank higher by optimizing the content of the page itself. For each of the individual criteria the maximum score is 100%. A score below 70% is considered to be indication that the page is not complying with general SEO standards and should be evaluated and/or fixed. Not every factor is weighted the same and some are not as important as others. Relatively unimportant factors like meta keywords are not included in the overall score.
Item | Factor | Pointers | |
---|---|---|---|
PageTitle | 100% | Far too many sites lack a page title. A page title is the first thing that shows in the search results so always use the title element. | |
Title relevance | 78% | A title should reflect the contents of a site. This site has a 60 % match | |
Title Length | 50% | Limit your title to anywhere between 40 and 70 characters. Your title was 126 characters long | |
Meta Description | 100% | A meta description is the second element that shows in the search results so always use the meta description. | |
Meta description length | 50% | The meta description should be between 145 and 160 characters. This meta description is 222 characters long. | |
Meta description relevance | 74% | Meta Description should reflect the contents of a site. This site has a 41 % match | |
Number of internal links | 50% | Linking to internal pages makes pages easier to find for search engines. Try to keep the number of links on your page roughly below 100. There are 172 internal links on this page. | |
Folder structure | 100% | We found a folder structure in the links on your page. A good folder structure makes a site easier to navigate. We found 12 level 1 folders and 17 folders above or in the first level of navigation. | |
Headings | 23% | Headers should reflect the contents of a site. This site has a 10 % match | |
Links | 16% | Link anchors should to some degree reflect the contents of a site. This site has a 8 % match | |
Image alt tags | 36% | Image alt tags should to some degree reflect the contents of a site. This site has a 13 % match | |
Bold and italic | 99% | Bold and italic tags should reflect the contents of a site to some degree. This site has a 33 % match | |
Html ratio | 30% | Try to keep the html / text ratio as low as possible. More html means longer loading times. Layout should be handled in a serpate css file | |
Image descriptions | 92% | 91.666666666667 % of all images have been described via the "alt" attribute. Describing images with relevant text may lead to better results in the search engines. | |
Page errors | 100% | Pages with no errors display significantly faster on most browsers. We detected 0 errors and warnings | |
WordCount | 35% | An ideal page contains between 400 and 600 words.This page contains 1504 words | |
Server response time | 30% | A slow server slows down a website. This server responds 903.56% slower the average | |
Gzip Compression | 100% | This site uses Gzip compression to display faster | |
Keywords in Domainname | 100% | There are important keywords in your domain name | |
Keywords in domain path | 100% | There are important keywords in the domain path | |
Structured Data | 100% | Structured data makes it easier for search engines to index your website | |
Inline css | 0% | Do not use inline css declarations. Inline css will slow down the rendering of the website. We detected 36 inline style declarations ( <a style="color:green">) with a size of 1159 bytes | |
Excessive use of the same words | 100% | There is no indication that there are one or more keywords that are used excessively. | |
Frames or iframes | 20% | The use of (i)frames can lead to problems crawling your page. Wij found 1 frame(s) on your page | |
Flash | 100% | Perfect, we detected no flash objects on your page | |
Css | 100% | Perfect, we did not detect too many CSS files | |
Javascript | 30% | Wij detected too much (10) blocking JavaScript files. Try to combine or defer the loading of JavaScript files | |
Mobile Website | 100% | Perfect, we found a responsive design for mobile users | |
Most important heading | 100% | Perfect, we detected a correct use of the most important (h1) heading! | |
Normalized headings | 40% | We dit not font a normalized heading structure. A heading 2 (h2) for example should be followed by a heading of an equal level (h2), a child heading (h3) or even a aprent heading (h1). |
How would you like to have SEO advice for all your pages ?? Start your SEO Dashboard and optimize your website!
www.losandes.com.ar images and descriptions
53 images found at www.losandes.com.ar Images can improve the user experience for a website by making a pag visually appealing Images can also add extra keyword relevance to a webpage by using alt tags. Images can also slow down a website. If the width and height for a picture is not specified for a browser know in advance how large the image is. A browser must first load the picture and see before it knows how much space should be on the page. Upon reservation In the meantime, the browser can do little but wait. When the height and width for the plate are given in the HTML code, a browser just continues to build for a page while the images load in the background.
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/close_white.svg?d=2178 height: 14px width: 12px description: cerrar |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/menu.svg?d=2178 height: 20px width: 17px description: menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/search.svg?d=2178 height: 20px width: 18px description: no alt description found |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/los-andes-140.svg?d=2178 height: 40px width: 160px description: los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/close.svg?d=2178 height: 18px width: 18px description: cerrar menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/chevron_down.svg?d=2178 height: 14px width: 12px description: no alt description found |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/facebook.svg?d=2178 height: 24px width: 24px description: facebook los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/x.svg?d=2178 height: 24px width: 24px description: twitter los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/instagram.svg?d=2178 height: 24px width: 24px description: instagram los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/youtube.svg?d=2178 height: 24px width: 24px description: youtube los andes |
|
https://www.losandes.com.ar/resizer/h1bfaimnkcqclcheujzcljgrtek=/100x100/smart/s3.amazonaws.com/arc-authors/grupoclarin/40f51e5d-0aba-4a8c-bc59-c5d00ff59f98.jpg height: 100px width: 100px description: juan manuel torrez |
|
https://www.losandes.com.ar/resizer/rfxtz0jyqbqdkudcp0qki3e-5ny=/0x0:0x0/980x640/filters:quality(80):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/7oehqya5fvhbbjef3kyf2dxadu.jpg height: 640px width: 980px description: esther sánchez, rectora de la uncuyo. foto: ignacio blanco / los andes |
|
https://www.losandes.com.ar/resizer/hpdpgpsspqwisskoyvbbrsj8de0=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/eduuakwbxjeurkggcmf4txbz6y.jpg height: 173px width: 307px description: javier milei dijo que privatizará el conicet en caso de ser electo presidente |
|
https://www.losandes.com.ar/resizer/vjbwi_wjayyrqelbvbrl0owz8iw=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/k5upzgzovzfjznpas7fyk4utau.jpg height: 173px width: 307px description: qué fue el plan bonex y por qué massa acusó a milei de querer implementarlo |
|
https://www.losandes.com.ar/resizer/m-zxiymywy3cb-2r8khhw_llika=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/pzbhkhbcx5gpllepdx7qq73gmu.jfif height: 173px width: 307px description: javier_milei |
|
https://www.losandes.com.ar/resizer/vjztnhxqvo0evjqbmvipclz3tuk=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/annjysxd2japrbxuti3n2hbmqq.jpg height: 173px width: 307px description: luis petri |
|
https://www.losandes.com.ar/resizer/bsu2v8qnqyfc5y427uoza33lgmk=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/5uxzwt64l5hzpizf7kwp5yjnxi.jpg height: 173px width: 307px description: paso 2023: javier milei el candidato más votado en argentina |
|
https://www.losandes.com.ar/resizer/0jhf02ozi6usdft2x9zsn4rfaso=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/wgwgahe4jngy3o44pjsk6mi3wy.jpg height: 360px width: 640px description: trasladaron a la madre de lucio dupuy |
|
https://www.losandes.com.ar/resizer/r3z_qibkr8idhwca9fvpm6m4di0=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/pdtppph5srd7xhpx5ismwqwj7e.jpg height: 360px width: 640px description: vuelve al parque central una de las expos de diseñadores más importante de mendoza |
|
https://www.losandes.com.ar/resizer/tqf6adyctf-8bzih80u18uk91ag=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/62cg2r4di5avdlzrt7ljmbjctq.png height: 360px width: 640px description: sportotal |
|
https://www.losandes.com.ar/resizer/zvpiejh-0k4tnprc9lje41sh2c4=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/rlt7gtsghbahlhllkeud2wkjjq.jpg height: 360px width: 640px description: vuelve el frío |
|
https://www.losandes.com.ar/resizer/uuwq-w0ydva1ib9_k_ge9blmckc=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/d2z7rsmg4jfevjhcp5xlyrgzpi.png height: 88px width: 156px description: cédula azul |
|
https://www.losandes.com.ar/resizer/jquygeqa4v7oqd4xyxidhep7ofe=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/e3wx2rxd6fbfli5pmvbwxd3bcu.jpg height: 88px width: 156px description: billetera virtual. |
|
https://www.losandes.com.ar/resizer/7z6kd1iol9_uuxyempl6d8azrmq=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/na4eku3x75dyljqpg4abpukhvm.png height: 88px width: 156px description: voucher educativo. |
|
https://www.losandes.com.ar/resizer/9nroctcw25qgesmigr-5vfjjj2g=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/75pny4u6kva3fm3vdpvfuquz2e.jpg height: 88px width: 156px description: cubiertas pirelli |
|
https://www.losandes.com.ar/resizer/pzdhgycp0djoznsd4bn98gmi3fo=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ot7h3zxgr5dm7eqtqthr5kamv4.jpg height: 88px width: 156px description: vouchers educativos. |
|
https://www.losandes.com.ar/resizer/dt0szxg2h6cehsx9rnssohbjjly=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/tlcqgi73cbbwnbvapagx65vmfy.jpg height: 88px width: 156px description: basura |
|
https://www.losandes.com.ar/resizer/5oz3rxqdmzplz6fezugrfiitriu=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/wfbkk76h65ailktmr4wbdbr6s4.jpg height: 88px width: 156px description: pan montaña rusa |
|
https://www.losandes.com.ar/resizer/smwv_wyxze_sebzfvogjpgjhvpw=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/cacpcl5l5vggdnmejdq4d6f2ou.jpg height: 88px width: 156px description: una estudiante de la universidad más cara de argentina desveló un rumor de la facultad y sorprendió a todos |
|
https://www.losandes.com.ar/resizer/fxx6_jb2r3yhvhqmmudlgo-2mge=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/23y2h5g7cbcwni6h4qndcxbjye.jpg height: 88px width: 156px description: una médica se negó a ceder su asiento de primera clase para que un niño viaje con su familia y armó la polémica |
|
https://www.losandes.com.ar/resizer/sk5zxbnkgbpfza4hv4bdblqt-x8=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/76fdnu3uezak5ko2fszya6mfyq.jpg height: 88px width: 156px description: tostadoras |
|
https://www.losandes.com.ar/resizer/-ahsahmupirnesw_jql_obr_bo8=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/a36ewtme4rdpbmsrtfb35cdewq.png height: 180px width: 360px description: ¿estamos todas? podcast |
|
https://www.losandes.com.ar/resizer/xdpf7t1gtswp-zyjtetqhchri9c=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/wpl5jnmocncljnaqe24i3n3vm4.jpg height: 180px width: 360px description: investigación clave en valle de uco: buscan resolver el conflicto entre productores ganaderos y carnívoros nativos |
|
https://www.losandes.com.ar/resizer/nruyiscljjf5_0fum9pnkv2gixs=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/zuruptnazje6vfnybpmaytzxk4.jpg height: 180px width: 360px description: regresaron a su hábitat a 21 aves que habían sido rescatadas en cautiverio y luego de rehabilitarlas. foto: prensa ministerio de ambiente y energía. |
|
https://www.losandes.com.ar/resizer/cjcnozcxtrgg7_-am4w6jgnwux4=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ilfavaijrncktpyggojg22ksim.jpg height: 180px width: 360px description: tenso cruce entre marra y grabois |
|
https://www.losandes.com.ar/resizer/ld5ofc3y5yruqyuq6sfn8fjjvli=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/lrvedprbfrdrbbcmwjpvchd3o4.jpg height: 180px width: 320px description: residencias médicas |
|
https://www.losandes.com.ar/resizer/gch1hemzels7kp-ven9rwxhy4sq=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/jledxgtptzdebbumii74etyaie.jpg height: 180px width: 320px description: empleados judiciales |
|
https://www.losandes.com.ar/resizer/tioi_whjbnqlnozk5c_3coarhs8=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/qvecttsxtvcqrocfzviuk5psmi.jpg height: 180px width: 320px description: norma abate de mazzucchelli. |
|
https://www.losandes.com.ar/resizer/_hatcate3t0874ctdtozbrqzic8=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/t2xj6cslyrebraq2m6lkkqtdbi.jpg height: 180px width: 320px description: antonio de masterchef emocionó a sus fans. / tiktok |
|
https://www.losandes.com.ar/resizer/nuioshk_qeghhe442i6o4eehl4g=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/wgwgahe4jngy3o44pjsk6mi3wy.jpg height: 180px width: 320px description: trasladaron a la madre de lucio dupuy |
|
https://www.losandes.com.ar/resizer/jpcfz1loperdtg1vfgcvm19cgtw=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/amfgf245vnh4zmiohioliata74.jpg height: 180px width: 320px description: ulpiano suarez visitó los trabajos realizados en el pasaje los lirios |
|
https://www.losandes.com.ar/resizer/4pd-uuxhwfiwwuprsnceabjvjfa=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/c2jpyp4vh5garh2akpn2hq24dq.png height: 180px width: 360px description: maría laura belvedere |
|
https://www.losandes.com.ar/resizer/pkmm3bwg9ypos7m7qwmnadmlily=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/cf3r2dxtnfcv5legn37wit5si4.jpg height: 180px width: 360px description: apareció un nuevo yaguareté en corrientes. |
|
https://www.losandes.com.ar/resizer/wy1oaexjksg5acgpxbcsbgfart8=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/prbh4cujfzevtk7jo6k5y4q3vu.jpg height: 180px width: 360px description: el navegante rosarino que logró ser el primer argentino en cruzar el atlántico en vela. |
|
https://www.losandes.com.ar/resizer/xydzondn-cpylub4jipnqng7vri=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/3yneisr3xjfnbn5lcvbpd6ojfa.jpg height: 180px width: 360px description: héroes y heroínas cotidianos |
|
http://www.losandes.com.ar/data:image/png;base64,ivborw0kggoaaaansuheugaaaiaaaacacamaaad04jh5aaaaa3ncsvqicajb4u/
gaaaacxbiwxmaahycaab2hagnwnjqaaaagxrfwhrtb2z0d2fyzqb3d3cuaw5rc2nhcguub3jnm+48ggaaalhqtfrf/
///aaaaaqacaaaaaqacaaaaaqacaaaaaaaaaqacaqacaaaaaqacaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaqacaaa
aaaaaaqacaaaaaaaaaqacaaaaaaaaaqacaaaaaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaaaaaaaaaqacaaaaaaaaa
aaaaaaaaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaqacaqacaaaaaqacaaaaaaaaaqacaaaeaqacaaaeaqacaaaeaaa
eaqacaqacaaadaqacaaadaaadaqacaaadaaadaaadaqacaqacaqacaaadaaadaqacaqacaaacaqacaaacaaacaaaca
qacaaacaqacaaacaaacaqacagacaqacaqacaqacagacaqacagacaqacagacaqacagacagacagacagacagacaqacaga
cagacaqacaqacagacagacaqacagacagacagacagacagacaqacaqacagacagacaqacaqacaqabaqabaqabaqabaqaca
qabaqacaqabaqacaqabaqabaqacaqabaqabaqacaqacaqacaqadaqacaqacaqadaqacaqadaqadaqacaqadaqacaqa
caqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqaca
qacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacce3ibgaaamd
0uk5taaebawmebaugbggjcqolcwwmdq0odhesehqvfryxgbkahbwdhh8fisikjicokywumdayndu4otk8pt0+pz9aq
kndrudhsk5rulntvlhbw1xdzwzmaglpam9xc3r8fx+cgooehywgh4iiiymki4ynjo6plzawmpudnp+jpkwnqkmrrq+
xs7s0tbw2ulm6ury9v8hcwspfxsfjysvmzc7p0nht1nxw19na3d7f4ohj5oxm5+jq6+zt7u/w8vp09fb3+pn6+/z9/
gihbkwaaacvsurbvhjaxvvrqxvffp9bgeimkwlma5xuflncfacrcmguqifyipeskljqk9icfspcswsfmesim6+gfin
4qa2bzp+tpnb3zvbe2d2z2utzpu3doef8zt2zoxpomrlahejtcksbwjt7+4fgxob6eztbg0pzu+lxv1bszm37omglw
fbaznhpby9or+ganxxpvks8pxqa4dceuwmi0z0jg0opvqrkqifbv0twhrq+pwnskktjppsqww87bsjr6w0hgc84zyj
tuqzp8ikn7ztf7+loaayvq6tvbonouw/hdtlre3xu8qoo0sftdqvpcvbohlscuvbhhoyhxvhq+fv6gvrndfdmxnjxx
2rudk8eifrtuyspqaoa+t1fc9ykfhr1b02iqgil3u8m0hojpelmmqn8robop8jiybq26risj/e3ivkuwkwhsythw2u
sn/9strikgpxl1m6okviq3wirhshw6cpsayusrok1as4zvnksypbakj5vmcbqotnhvhdrrytcepqpyfjpli4sk1rbr
nujhd48aeeou0auepr/ll4v2asvt/axfgh8gzns92+mg2ekywf0rddxem302mqxqklfzjq+4zixwhlzj/irispnfoh
gz39qqzkfzsfklpwi6q1xzkqf6+5mhja236ud6/dheqn/fxrsfgaz/qbdtittbf3/jriqysqi46dtblmrop8phygnf
nq9vxyolzsjgnnaxft/cwokkbp/nwjaie7xvihha31x02nanm/peyes+hc0gdneywrleha8e2j8x4hpo0kalwq2zvb
vzrgce+dc5amrpbbsm31tu8mc39kvjjbnivnxgcf+wdxggiyxskmcv2zsmazju0alkkimdm7asi1yvshrdmkq6eegy
fxqv7bdgq0vbmiauzl8d4at/0wakdftnzl4rltgyywsqz5mx6cqu3jx7zlsem2jhl7hc2rljm1s/acjxp9chxqp++v
zkxyjobiv5atn9n0q4orzubr3uy0/zjdbn0wnbs4hjbsku0lyl364enme6vwqtbzfkoo0h5osrys8i3fwno3s+zep0
o/e8au5hhkkrjbfbct5r23+ufwmvfu+n3xeknzzroydmv+u2yted4927nue8ifyk+ozqd/rpp7olirtpsno49c94so
jvdsnyvr0uv9w7nydt2h96huv+acpoarbvwor8/daq7x/tdilpoqsfr/ldetd6j/7qf4/nvoajwvmgnofalhjqj0aa
mcowk9pq+ptphipbzbpslw6ghb5imj885q6pipnzkwatxyhaodmx6aox6jj0/cnfkc7oblibnazhuy2/6eypmlmbb4
dwcdz7e6rb1gkd1xx6b8ebojnwtoha7b+hed9+6yqpupm9ngaixsigydtdnfon02k+ciguumu+zgmaab20rtuzktq+
egzbxjraj4mibqavrtw+jilfcsyeqvomp07xokwhfztkao+yo5wnkdv/9qjyudycynhevjo8cu0wixkdehiy+zzj/j
omisv6pu/tciiy16vn3y0+kv60a9we1h63rm+qrx0y8j/vc+naguhvecj3i83hde5r0hp04qhfoikx9qnyof/xcz1a
1s7onrsa8nrlbtacrbwb4zb60tvb6hankwomow98xsnozijqub4obmz1ryriiuu5nri42eskqgrvlimwpzpf6fphyu
moiur/hlm4h/gc3/sx3uf8znlwdogyfepaxizsvt3irrabcsyivkgpvaaptywvl3qacykkwxkg/gbt2jaorjezhea8
zjhoyv/kxnlpk23vgszwitluokjh9+stvowcubbehoj1mwohzhkgy7mdjfakpqjj6cs/ifwpsjvadopsfcdlmmpchr
uga88w6stx1wnsktnogukr3zgewbpe78lvrvaiviiyfep8hhe/jsy7he2ikbei1skcsuhxqvp65odqj3gl1kjloke8
ie36imn0a0o+ifloofcjyv/sb3md2jaem+dpvtgodk9vcuid3xa+w4ut2mkltw6fauf8ygdlppyfbue4gk1s7m+jmf
3kzuj7gvke57vkhjlescni9rjcxxgxo+uex+xg7dh4bhl0yydd8z9lbdf5tlwtmwcn618po0argjjnskwjnocbdbyh
cghbbs2oxxgzw1zgecmaptto6eny92s+mcgh1msjzhtdhuxdlu3yd8ahmfmlkgcdowyhmemloy4qbutw6fn67d32nz
nqzchlv/2/xxglqfbfvna+/a9/gmm2o9w6d/eov0yj/6dtpqpcmk/zkb/oj/+a436j3rqp9sq/1iv/opn+o926z/cr
v94v/4ldvqveed7jrfov+aj/6ittf/1gv7lbtb+3q/qfuer0h7le9b+6rxqfu0xgo6lzwc0x/2eiq2x3wmf8pr/fzo
wq4z4gntdaaaaaelftksuqmcc height: height attribute not set width: width attribute not set description: adzocalo |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/los-andes-white.svg?d=2178 height: 28px width: 102px description: los andes white |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/chevron_up-white.svg?d=2178 height: 20px width: 16px description: menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/facebook-white.svg?d=2178 height: 24px width: 24px description: facebook los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/x-white.svg?d=2178 height: 24px width: 24px description: twitter los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/instagram-white.svg?d=2178 height: 24px width: 24px description: instagram los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/youtube-white.svg?d=2178 height: 24px width: 24px description: youtube los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/wyleex.svg?d=2178 height: 20px width: 95px description: wyleex |
How are images contributing to your SEO site-wise ? Your leading content tool has the awnsers!