www.losandes.com.ar website review
Improve your SEO :: free trial!
www.losandes.com.ar is 66% geoptimaliseerd!
SEO Keyword summary for www.losandes.com.ar/sociedad/los-casos-de-dengue-aumentaron-300-en-tres-semanas-en-mendoza-pero-se-observa-una-tendencia-a-la-baja/
Keywords are extracted from the main content of your website and are the primary indicator of the words this page could rank for. By frequenty count we expect your focus keyword to be que
Focus keyword
Short and long tail
Short Tail Keywords que los las |
long Tail Keywords (2 words) que se y el los andeshace los casos el ministerio |
long Tail Keywords (3 words) ministerio de salud casos de dengue dos primeras muertes primeras muertes por los andeshace 1 dengue en mendoza observa una tendencia |
www.losandes.com.ar On-Page SEO Scan
Descriptive Elements
The <head> element of a www.losandes.com.ar/sociedad/los-casos-de-dengue-aumentaron-300-en-tres-semanas-en-mendoza-pero-se-observa-una-tendencia-a-la-baja/ page is used to inform the browser and visitors of the page about the general meta information. The head section of the page is where we place the page title, the definition of the HTML version used, the language of in which the page is written. In the head section we can also include JavaScript and CSS (markup) files for the page.
Page title
Title length
los casos dengue aumentaron tres semanas mendoza pero observa una tendencia baja
Meta description
Meta description legth
Meta description SEO
ministerio salud determin que hay departamentos condicin brote aunque totalidad ellos pertenecen rea metropolitana mendoza adems confirmaron las dos primeras muertes por enfermedad provincia
Content SEO
Number of Words
Spam detected?
Headings
Heading distribution
Heading normalisation
Heading SEO impact
Emphasis (bold and italic)
Emphasis SEO impact
Images
Number of images
Images dimensions
Image alt descriptions
Images SEO impact
cerrar menu logo los andes facebook twitter instagram youtube vernica vita casos dengue aumentaron tres semanas mendoza pero observa una tendencia baja ministerio salud determin que hay departamentos condicin brote aunque totalidad ellos pertenecen rea metropolitana adems confirmaron las dos primeras muertes por enfermedad provincia fumigacin tanto local como zona regin capital san rafael respecto del primer territorio destaca brotes significativos todas secciones ciudad urbanas heras incluye esta situacin guaymalln godoy cruz plata producir propio repelente para combatir proliferacin mosquitos confirm estas haban conocido hace unas cuales sospechaba vinculacin con virus aguardaba confirmacin autopsia trascendido manera extraoficial analizara tercer caso mientras funcionaria aclar mayora cuadros presentan son leves muy pocas internaciones guardia hospital notti imagen ilustrativa cmo cobrar plan das ests embarazada alimentacin saludable clave prevenir diabetes tipo cdula azul billetera virtual vouchers educativos voucher educativo taladro makita ascensin jess vitral jueves cul signo zodaco mala suerte retrato carlos iii vendedor ambulante mendocino robo palermo revelaron contenido dibujos lucio dupuy nene asesinado madre novia acto apertura judicial gran hermano fundacional sesion senado villarruel bloques mara laura belvedere apareci nuevo yaguaret corrientes navegante rosarino logr ser argentino cruzar atlntico vela hroes heronas cotidianos adzocalo white wyleex
Mobile SEO www.losandes.com.ar/sociedad/los-casos-de-dengue-aumentaron-300-en-tres-semanas-en-mendoza-pero-se-observa-una-tendencia-a-la-baja/
Mobile rendering
Mobile optimizations
Responsive design detected (mobile css)
No flash detected !
Mobile improvement
Marketing / lead generation for www.losandes.com.ar/sociedad/los-casos-de-dengue-aumentaron-300-en-tres-semanas-en-mendoza-pero-se-observa-una-tendencia-a-la-baja/
Social Media
Facebook shares | Facebook likes | ||
Facebook comments | Tweets | ||
Google +1 |
Conversion form
Search form
Analytics
Online presence
SERP Preview
SERP Title
The title is trucated
SERP Link
SERP Description
Domain Level SEO
Domain name
19 characters long
Domain name SEO Impact
los found in domain name !
Path name
casos found in path !
dengue found in path !
los found in path !
mendoza found in path !
observa found in path !
pero found in path !
semanas found in path !
tendencia found in path !
una found in path !
Structured data
Publisher Markup
Other Structured data
Website configuration
Correct processing of non-existing pages?
Favicon icon found?
HTML request without WWW redirected correctly?
Robots.txt found?
Sitemap found?
Navigation and internal links
Navigation
Url seperator
Human readable urls
Number of links
Link SEO Impact
ver promos de suscripcin
los andes
clasificados
auditorio
cmo anunciar
publicity
publicity
los andes san juan
|
autor vernica de vita
redaccin los andes
lautaro domnguez
mauricio videla
carolina ramos
roco ledesma
maia had
lisandro tosello
|
economia cunto hay que invertir para ganar un sueldo de 200000 en mercado pago
vouchers educativos cmo saber si la solicitud fue aprobada y cundo se cobran
el gobierno de milei confirm que no habr ms voucher educativo cmo quedan las cuotas de las escuelas
sorpresa por los precios en chile cunto sale un taladro percutor makita
el banco jp morgan hizo un recorte en la expectativa de inflacin en argentina para el 2024
ley fiscal la suprema corte rechaz un pedido de los desarrolladores inmobiliarios mendocinos
|
espectaculo los acompaantes de cuatro concursantes quedaron nominados esta semana en gran hermano
da internacional de los museos todas las actividades gratuitas que ofrece la ciudad de mendoza
|
intent |
mundo llevaron a su hija al hospital porque le dola la panza y el diagnostico los impact
|
policiales separaron a las asesinas de lucio dupuy la madre del nio fue trasladada a un penal de mendoza
|
politica con guios a la ucr por fondos educativos se intensifican las negociaciones por la ley bases
|
por-las-redes el evangelio de hoy 16 de mayo me has amado desde antes de la creacin del mundo
jueves 16 cul es el signo del zodaco con ms mala suerte
develaron el particular primer retrato oficial de carlos iii como rey y estallaron los memes
video revent una puerta de vidri a plena luz del da y se rob una bici fija de 8 mil dlares
|
salud |
services cartelera de cine
cartelera de espectculos
|
sharer |
sociedad edicin impresa
brote de dengue por qu los especialistas advierten que la fumigacin no es suficiente
epidemia de dengue
el debate por la vacuna contra el dengue qu piensan expertos mendocinos
dengue en mendoza qu factores favorecen la circulacin en la provincia segn especialistas
con el fro subieron las consultas por enfermedades respiratorias aunque estn dentro de la media
en mendoza 2 de cada 10 nacimientos son de madres de ms de 35 aos
cundo se inician las enfermedades frecuentes del adulto
sin cdula azul cmo hay que hacer para autorizar a un tercero a manejar tu auto
el vendedor ambulante que se hizo viral tras una estafa agradeci la ayuda me encantara tener mi propia cafetera
un informe revel que durante el 2023 hubo un aumeto del antisemitismo en medios digitales
|
temas podcast
contenido exclusivo
salud
dengue
mendoza
|
www.losandes.com.ar sociedad
poltica
economa
opinin
deportes
policiales
fincas
arquitectura
editorial
escribe al lector
espectculos
estilo
muy tecno
mundo club house
sociales
turismo
vecinos
receptorias
por las redes
|
Links to external pages
Outloing links
losandes2.mitiendanube.com
www.guarda14.com
www.guarda14.com
losandespass.com.ar
www.rumbosdigital.com
losandes2.mitiendanube.com
tintero.com.ar
eventos.losandespass.com.ar
www.facebook.com
www.youtube.com
viapais.com.ar
viapais.com.ar
viapais.com.ar
viapais.com.ar
viapais.com.ar
www.lavoz.com.ar
www.lavoz.com.ar
www.clarin.com
www.ole.com.ar
entremujeres.clarin.com
www.viapais.com.ar
www.tycsports.com
tn.com.ar
www.ciudad.com.ar
www.eltrecetv.com.ar
radiomitre.cienradios.com
la100.cienradios.com
ar.cienradios.com
www.wyleex.com
SEO Advice for www.losandes.com.ar
In this section we provide pointers on how you can to optimize your web page so it can be found more easily by search engines and how to make it rank higher by optimizing the content of the page itself. For each of the individual criteria the maximum score is 100%. A score below 70% is considered to be indication that the page is not complying with general SEO standards and should be evaluated and/or fixed. Not every factor is weighted the same and some are not as important as others. Relatively unimportant factors like meta keywords are not included in the overall score.
Item | Factor | Pointers | |
---|---|---|---|
PageTitle | 100% | Far too many sites lack a page title. A page title is the first thing that shows in the search results so always use the title element. | |
Title relevance | 98% | A title should reflect the contents of a site. This site has a 75 % match | |
Title Length | 50% | Limit your title to anywhere between 40 and 70 characters. Your title was 104 characters long | |
Meta Description | 100% | A meta description is the second element that shows in the search results so always use the meta description. | |
Meta description length | 50% | The meta description should be between 145 and 160 characters. This meta description is 250 characters long. | |
Meta description relevance | 97% | Meta Description should reflect the contents of a site. This site has a 54 % match | |
Number of internal links | 50% | Linking to internal pages makes pages easier to find for search engines. Try to keep the number of links on your page roughly below 100. There are 166 internal links on this page. | |
Folder structure | 100% | We found a folder structure in the links on your page. A good folder structure makes a site easier to navigate. We found 13 level 1 folders and 18 folders above or in the first level of navigation. | |
Headings | 23% | Headers should reflect the contents of a site. This site has a 10 % match | |
Links | 12% | Link anchors should to some degree reflect the contents of a site. This site has a 6 % match | |
Image alt tags | 39% | Image alt tags should to some degree reflect the contents of a site. This site has a 14 % match | |
Bold and italic | 51% | Bold and italic tags should reflect the contents of a site to some degree. This site has a 17 % match | |
Html ratio | 30% | Try to keep the html / text ratio as low as possible. More html means longer loading times. Layout should be handled in a serpate css file | |
Image descriptions | 92% | 91.525423728814 % of all images have been described via the "alt" attribute. Describing images with relevant text may lead to better results in the search engines. | |
Page errors | 100% | Pages with no errors display significantly faster on most browsers. We detected 0 errors and warnings | |
WordCount | 20% | An ideal page contains between 400 and 600 words.This page contains 2323 words | |
Server response time | 30% | A slow server slows down a website. This server responds 852.33% slower the average | |
Gzip Compression | 100% | This site uses Gzip compression to display faster | |
Keywords in Domainname | 100% | There are important keywords in your domain name | |
Keywords in domain path | 100% | There are important keywords in the domain path | |
Structured Data | 100% | Structured data makes it easier for search engines to index your website | |
Inline css | 0% | Do not use inline css declarations. Inline css will slow down the rendering of the website. We detected 36 inline style declarations ( <a style="color:green">) with a size of 1159 bytes | |
Excessive use of the same words | 100% | There is no indication that there are one or more keywords that are used excessively. | |
Frames or iframes | 20% | The use of (i)frames can lead to problems crawling your page. Wij found 1 frame(s) on your page | |
Flash | 100% | Perfect, we detected no flash objects on your page | |
Css | 100% | Perfect, we did not detect too many CSS files | |
Javascript | 30% | Wij detected too much (10) blocking JavaScript files. Try to combine or defer the loading of JavaScript files | |
Mobile Website | 100% | Perfect, we found a responsive design for mobile users | |
Most important heading | 100% | Perfect, we detected a correct use of the most important (h1) heading! | |
Normalized headings | 40% | We dit not font a normalized heading structure. A heading 2 (h2) for example should be followed by a heading of an equal level (h2), a child heading (h3) or even a aprent heading (h1). |
How would you like to have SEO advice for all your pages ?? Start your SEO Dashboard and optimize your website!
www.losandes.com.ar images and descriptions
53 images found at www.losandes.com.ar Images can improve the user experience for a website by making a pag visually appealing Images can also add extra keyword relevance to a webpage by using alt tags. Images can also slow down a website. If the width and height for a picture is not specified for a browser know in advance how large the image is. A browser must first load the picture and see before it knows how much space should be on the page. Upon reservation In the meantime, the browser can do little but wait. When the height and width for the plate are given in the HTML code, a browser just continues to build for a page while the images load in the background.
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/close_white.svg?d=2176 height: 14px width: 12px description: cerrar |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/menu.svg?d=2176 height: 20px width: 17px description: menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/search.svg?d=2176 height: 20px width: 18px description: no alt description found |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/los-andes-140.svg?d=2176 height: 40px width: 160px description: los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/close.svg?d=2176 height: 18px width: 18px description: cerrar menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/chevron_down.svg?d=2176 height: 14px width: 12px description: no alt description found |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/facebook.svg?d=2176 height: 24px width: 24px description: facebook los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/x.svg?d=2176 height: 24px width: 24px description: twitter los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/instagram.svg?d=2176 height: 24px width: 24px description: instagram los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/youtube.svg?d=2176 height: 24px width: 24px description: youtube los andes |
|
https://www.losandes.com.ar/resizer/cfq-0iey-os-oyiinzyu-9i6yky=/100x100/smart/s3.amazonaws.com/arc-authors/grupoclarin/6c88f87f-7bb2-4035-83a6-4c5facef5590.png height: 100px width: 100px description: verónica de vita |
|
https://www.losandes.com.ar/resizer/fbpzntbteukplvjlotopfeawsjw=/0x0:0x0/980x640/filters:quality(80):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/3ep32nu3y5dinnztncmuc5j7r4.jpg height: 640px width: 980px description: los casos de dengue aumentaron 300% en tres semanas en mendoza pero se observa una tendencia a la baja. el ministerio de salud determinó que hay 5 departamentos en condición de brote aunque no en su totalidad. de ellos, 4 pertenecen al Área metropolitana de mendoza. además, se confirmaron las dos primeras muertes por la enfermedad en la provincia. |
|
https://www.losandes.com.ar/resizer/wdidqzsixopygxgxywqswjf5zzi=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/36nexrwqvfa7ricbirjuch3ory.jpg height: 173px width: 307px description: fumigación por dengue en mendoza |
|
https://www.losandes.com.ar/resizer/h34wi_jtj-gxfcpils26vcoel-a=/1023x575/smart/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/7zfx2yibrndg5k75qaayhjbiii.jpg height: 575px width: 1023px description: en tanto, el ministerio de salud local determinó como zona de brote, 4 departamentos de la región metropolitana y la capital de san rafael. respecto del primer territorio, destaca que hay brotes significativos en todas las secciones de la ciudad de mendoza y en todas las urbanas de las heras; incluye en esta situación de brote a guaymallén y godoy cruz. |
|
https://www.losandes.com.ar/resizer/mwnylijgcyjls7wgtapkmeaxkae=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/nufsi5iczngjrmouem2aonb6wq.jpg height: 173px width: 307px description: dengue |
|
https://www.losandes.com.ar/resizer/gtix7mmcqdu66wrbox0oncssu8s=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/2m2vhkzf4zeldc6towu422ybge.jpg height: 173px width: 307px description: la plata producirá su propio repelente para combatir la proliferación de mosquitos |
|
https://www.losandes.com.ar/resizer/2dr-14xnr_vf9uusyr1aub0u9q4=/1023x682/smart/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/2ql3po77fbdnvd4vdfonwwzena.jpg height: 682px width: 1023px description: el ministerio de salud confirmó las dos primeras muertes por dengue en mendoza. estas ya se habían conocido hace unas semanas, de las cuales se sospechaba su vinculación con el virus, pero se aguardaba la confirmación de la autopsia. en tanto ha trascendido de manera extraoficial que se analizaría un tercer caso mientras que la funcionaria aclaró que la mayoría de los cuadros que presentan son leves, con muy pocas internaciones. |
|
https://www.losandes.com.ar/resizer/ozhswpxttp7zf68owllk0l5kygi=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/7rmb6dusfzhunopv64iiznkm7y.jpg height: 360px width: 640px description: guardia hospital notti |
|
https://www.losandes.com.ar/resizer/1n3xnpwh_6oq2upznz5wukbamuw=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/mjrtenddgnsdmzjsmy2tqntdmi.jpg height: 360px width: 640px description: / imagen ilustrativa |
|
https://www.losandes.com.ar/resizer/0omz7mpkopozpipu39m7s9gomle=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ojnmg4k2evef5gy4qqliuxrfgu.jpg height: 360px width: 640px description: cómo cobrar el plan 1000 días si estás embarazada. |
|
https://www.losandes.com.ar/resizer/4caqibraupcz3uwi4phszvn5kv4=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/r5zagv32ybh7powh7jvrjj5vla.jpg height: 360px width: 640px description: alimentación saludable, la clave para prevenir la diabetes tipo 2 |
|
https://www.losandes.com.ar/resizer/uuwq-w0ydva1ib9_k_ge9blmckc=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/d2z7rsmg4jfevjhcp5xlyrgzpi.png height: 88px width: 156px description: cédula azul |
|
https://www.losandes.com.ar/resizer/jquygeqa4v7oqd4xyxidhep7ofe=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/e3wx2rxd6fbfli5pmvbwxd3bcu.jpg height: 88px width: 156px description: billetera virtual. |
|
https://www.losandes.com.ar/resizer/pzdhgycp0djoznsd4bn98gmi3fo=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ot7h3zxgr5dm7eqtqthr5kamv4.jpg height: 88px width: 156px description: vouchers educativos. |
|
https://www.losandes.com.ar/resizer/7z6kd1iol9_uuxyempl6d8azrmq=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/na4eku3x75dyljqpg4abpukhvm.png height: 88px width: 156px description: voucher educativo. |
|
https://www.losandes.com.ar/resizer/tejky5fuv6ucdji3m1_k_lgqpvs=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/t4yc3loe6nd5xe2djw3ez6ek3q.jpg height: 88px width: 156px description: taladro makita |
|
https://www.losandes.com.ar/resizer/kjgjxmlsec1dnzottxnjybk8xos=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/3gggkrhb5nd7pjtwhojkhrgwym.jpg height: 88px width: 156px description: ascensión jesús vitral |
|
https://www.losandes.com.ar/resizer/aidf_myas7i-hqg0swutzoh1twm=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/jc2m2mgugzca3ap3dup7v45kiu.jpg height: 88px width: 156px description: jueves 16: cuál es el signo del zodíaco con más mala suerte |
|
https://www.losandes.com.ar/resizer/18t8mbdbaiizkrdt-flcv_0klr4=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/u5jpob7tdrdj7buwvlpojpxhlq.jpeg height: 88px width: 156px description: retrato de carlos iii |
|
https://www.losandes.com.ar/resizer/58ecgodqqrquczjtruskwxztmws=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/jfaxfwt62fhv5ovbxuh7sfug2m.jpg height: 88px width: 156px description: vendedor ambulante mendocino |
|
https://www.losandes.com.ar/resizer/ekcudgmhmusm1azlvnhu4eaxoia=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ifuk27l7zng2xhh3lqxbqimguu.png height: 88px width: 156px description: robo en palermo |
|
https://www.losandes.com.ar/resizer/ra7m8vup5g0afhl3pqlbqouytsw=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/mvqwmzjvg4ytmn3fg5sggoldgq.jpg height: 180px width: 360px description: |
|
https://www.losandes.com.ar/resizer/tuxbaenmgn9ecxfip0lleguwyum=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/jfaxfwt62fhv5ovbxuh7sfug2m.jpg height: 180px width: 360px description: vendedor ambulante mendocino |
|
https://www.losandes.com.ar/resizer/hitcdfsv5vqn6j_tsa9xfockpyc=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/uv5ncdzxmjdj7ffwzanr3dpjz4.jpg height: 180px width: 360px description: revelaron el contenido de los dibujos de lucio dupuy, el nene asesinado por su madre y la novia |
|
https://www.losandes.com.ar/resizer/9llpivxzzhteeday3lupq891h7o=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/gq3ggyztmjsggytggbsgmzjwg4.jpg height: 180px width: 360px description: |
|
https://www.losandes.com.ar/resizer/1jcr1_sl-5nten_ste4ntab7pim=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/gs76e2jl25fypovavja5wb4o7m.jpg height: 180px width: 320px description: acto de apertura del año judicial 2023 |
|
https://www.losandes.com.ar/resizer/wwfs60mzsy7iiwaao_a0osmq3ju=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/kefdhxj6u5cddejbjjkv7erfny.jpg height: 180px width: 320px description: gran hermano |
|
https://www.losandes.com.ar/resizer/nuaf11ldovyl-azhmjeretcu_py=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/62fxdqxirbgf7hojaujdc4dff4.jpg height: 180px width: 320px description: Área fundacional |
|
https://www.losandes.com.ar/resizer/a-ombtjrhklbfmq2ojfyzopoph0=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/3gggkrhb5nd7pjtwhojkhrgwym.jpg height: 180px width: 320px description: ascensión jesús vitral |
|
https://www.losandes.com.ar/resizer/rhnzsrbjhiazqesjyuzl-gcwkfc=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/jmzfe4ohmneorly2uypxru5ch4.jpg height: 180px width: 320px description: sesion senado villarruel bloques |
|
https://www.losandes.com.ar/resizer/nrgkcyafvqd_vyug-dfrkd7ekfe=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/jc2m2mgugzca3ap3dup7v45kiu.jpg height: 180px width: 320px description: jueves 16: cuál es el signo del zodíaco con más mala suerte |
|
https://www.losandes.com.ar/resizer/4pd-uuxhwfiwwuprsnceabjvjfa=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/c2jpyp4vh5garh2akpn2hq24dq.png height: 180px width: 360px description: maría laura belvedere |
|
https://www.losandes.com.ar/resizer/pkmm3bwg9ypos7m7qwmnadmlily=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/cf3r2dxtnfcv5legn37wit5si4.jpg height: 180px width: 360px description: apareció un nuevo yaguareté en corrientes. |
|
https://www.losandes.com.ar/resizer/wy1oaexjksg5acgpxbcsbgfart8=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/prbh4cujfzevtk7jo6k5y4q3vu.jpg height: 180px width: 360px description: el navegante rosarino que logró ser el primer argentino en cruzar el atlántico en vela. |
|
https://www.losandes.com.ar/resizer/xydzondn-cpylub4jipnqng7vri=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/3yneisr3xjfnbn5lcvbpd6ojfa.jpg height: 180px width: 360px description: héroes y heroínas cotidianos |
|
http://www.losandes.com.ar/data:image/png;base64,ivborw0kggoaaaansuheugaaaiaaaacacamaaad04jh5aaaaa3ncsvqicajb4u/
gaaaacxbiwxmaahycaab2hagnwnjqaaaagxrfwhrtb2z0d2fyzqb3d3cuaw5rc2nhcguub3jnm+48ggaaalhqtfrf/
///aaaaaqacaaaaaqacaaaaaqacaaaaaaaaaqacaqacaaaaaqacaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaqacaaa
aaaaaaqacaaaaaaaaaqacaaaaaaaaaqacaaaaaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaaaaaaaaaqacaaaaaaaaa
aaaaaaaaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaqacaqacaaaaaqacaaaaaaaaaqacaaaeaqacaaaeaqacaaaeaaa
eaqacaqacaaadaqacaaadaaadaqacaaadaaadaaadaqacaqacaqacaaadaaadaqacaqacaaacaqacaaacaaacaaaca
qacaaacaqacaaacaaacaqacagacaqacaqacaqacagacaqacagacaqacagacaqacagacagacagacagacagacaqacaga
cagacaqacaqacagacagacaqacagacagacagacagacagacaqacaqacagacagacaqacaqacaqabaqabaqabaqabaqaca
qabaqacaqabaqacaqabaqabaqacaqabaqabaqacaqacaqacaqadaqacaqacaqadaqacaqadaqadaqacaqadaqacaqa
caqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqaca
qacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacce3ibgaaamd
0uk5taaebawmebaugbggjcqolcwwmdq0odhesehqvfryxgbkahbwdhh8fisikjicokywumdayndu4otk8pt0+pz9aq
kndrudhsk5rulntvlhbw1xdzwzmaglpam9xc3r8fx+cgooehywgh4iiiymki4ynjo6plzawmpudnp+jpkwnqkmrrq+
xs7s0tbw2ulm6ury9v8hcwspfxsfjysvmzc7p0nht1nxw19na3d7f4ohj5oxm5+jq6+zt7u/w8vp09fb3+pn6+/z9/
gihbkwaaacvsurbvhjaxvvrqxvffp9bgeimkwlma5xuflncfacrcmguqifyipeskljqk9icfspcswsfmesim6+gfin
4qa2bzp+tpnb3zvbe2d2z2utzpu3doef8zt2zoxpomrlahejtcksbwjt7+4fgxob6eztbg0pzu+lxv1bszm37omglw
fbaznhpby9or+ganxxpvks8pxqa4dceuwmi0z0jg0opvqrkqifbv0twhrq+pwnskktjppsqww87bsjr6w0hgc84zyj
tuqzp8ikn7ztf7+loaayvq6tvbonouw/hdtlre3xu8qoo0sftdqvpcvbohlscuvbhhoyhxvhq+fv6gvrndfdmxnjxx
2rudk8eifrtuyspqaoa+t1fc9ykfhr1b02iqgil3u8m0hojpelmmqn8robop8jiybq26risj/e3ivkuwkwhsythw2u
sn/9strikgpxl1m6okviq3wirhshw6cpsayusrok1as4zvnksypbakj5vmcbqotnhvhdrrytcepqpyfjpli4sk1rbr
nujhd48aeeou0auepr/ll4v2asvt/axfgh8gzns92+mg2ekywf0rddxem302mqxqklfzjq+4zixwhlzj/irispnfoh
gz39qqzkfzsfklpwi6q1xzkqf6+5mhja236ud6/dheqn/fxrsfgaz/qbdtittbf3/jriqysqi46dtblmrop8phygnf
nq9vxyolzsjgnnaxft/cwokkbp/nwjaie7xvihha31x02nanm/peyes+hc0gdneywrleha8e2j8x4hpo0kalwq2zvb
vzrgce+dc5amrpbbsm31tu8mc39kvjjbnivnxgcf+wdxggiyxskmcv2zsmazju0alkkimdm7asi1yvshrdmkq6eegy
fxqv7bdgq0vbmiauzl8d4at/0wakdftnzl4rltgyywsqz5mx6cqu3jx7zlsem2jhl7hc2rljm1s/acjxp9chxqp++v
zkxyjobiv5atn9n0q4orzubr3uy0/zjdbn0wnbs4hjbsku0lyl364enme6vwqtbzfkoo0h5osrys8i3fwno3s+zep0
o/e8au5hhkkrjbfbct5r23+ufwmvfu+n3xeknzzroydmv+u2yted4927nue8ifyk+ozqd/rpp7olirtpsno49c94so
jvdsnyvr0uv9w7nydt2h96huv+acpoarbvwor8/daq7x/tdilpoqsfr/ldetd6j/7qf4/nvoajwvmgnofalhjqj0aa
mcowk9pq+ptphipbzbpslw6ghb5imj885q6pipnzkwatxyhaodmx6aox6jj0/cnfkc7oblibnazhuy2/6eypmlmbb4
dwcdz7e6rb1gkd1xx6b8ebojnwtoha7b+hed9+6yqpupm9ngaixsigydtdnfon02k+ciguumu+zgmaab20rtuzktq+
egzbxjraj4mibqavrtw+jilfcsyeqvomp07xokwhfztkao+yo5wnkdv/9qjyudycynhevjo8cu0wixkdehiy+zzj/j
omisv6pu/tciiy16vn3y0+kv60a9we1h63rm+qrx0y8j/vc+naguhvecj3i83hde5r0hp04qhfoikx9qnyof/xcz1a
1s7onrsa8nrlbtacrbwb4zb60tvb6hankwomow98xsnozijqub4obmz1ryriiuu5nri42eskqgrvlimwpzpf6fphyu
moiur/hlm4h/gc3/sx3uf8znlwdogyfepaxizsvt3irrabcsyivkgpvaaptywvl3qacykkwxkg/gbt2jaorjezhea8
zjhoyv/kxnlpk23vgszwitluokjh9+stvowcubbehoj1mwohzhkgy7mdjfakpqjj6cs/ifwpsjvadopsfcdlmmpchr
uga88w6stx1wnsktnogukr3zgewbpe78lvrvaiviiyfep8hhe/jsy7he2ikbei1skcsuhxqvp65odqj3gl1kjloke8
ie36imn0a0o+ifloofcjyv/sb3md2jaem+dpvtgodk9vcuid3xa+w4ut2mkltw6fauf8ygdlppyfbue4gk1s7m+jmf
3kzuj7gvke57vkhjlescni9rjcxxgxo+uex+xg7dh4bhl0yydd8z9lbdf5tlwtmwcn618po0argjjnskwjnocbdbyh
cghbbs2oxxgzw1zgecmaptto6eny92s+mcgh1msjzhtdhuxdlu3yd8ahmfmlkgcdowyhmemloy4qbutw6fn67d32nz
nqzchlv/2/xxglqfbfvna+/a9/gmm2o9w6d/eov0yj/6dtpqpcmk/zkb/oj/+a436j3rqp9sq/1iv/opn+o926z/cr
v94v/4ldvqveed7jrfov+aj/6ittf/1gv7lbtb+3q/qfuer0h7le9b+6rxqfu0xgo6lzwc0x/2eiq2x3wmf8pr/fzo
wq4z4gntdaaaaaelftksuqmcc height: height attribute not set width: width attribute not set description: adzocalo |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/los-andes-white.svg?d=2176 height: 28px width: 102px description: los andes white |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/chevron_up-white.svg?d=2176 height: 20px width: 16px description: menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/facebook-white.svg?d=2176 height: 24px width: 24px description: facebook los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/x-white.svg?d=2176 height: 24px width: 24px description: twitter los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/instagram-white.svg?d=2176 height: 24px width: 24px description: instagram los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/youtube-white.svg?d=2176 height: 24px width: 24px description: youtube los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/wyleex.svg?d=2176 height: 20px width: 95px description: wyleex |
How are images contributing to your SEO site-wise ? Your leading content tool has the awnsers!