www.losandes.com.ar website review
Improve your SEO :: free trial!
www.losandes.com.ar is 66% geoptimaliseerd!
SEO Keyword summary for www.losandes.com.ar/economia/hot-sale-donde-y-como-denunciar-en-caso-de-ser-victima-de-una-estafa/
Keywords are extracted from the main content of your website and are the primary indicator of the words this page could rank for. By frequenty count we expect your focus keyword to be los
Focus keyword
Short and long tail
Short Tail Keywords los que las |
long Tail Keywords (2 words) los andeshace al consumidor que se hot sale para evitar |
long Tail Keywords (3 words) caso de ser recomendaciones para evitar defensa al consumidor direccin de defensa los andeshace 2 compra es importante medios de pago |
www.losandes.com.ar On-Page SEO Scan
Descriptive Elements
The <head> element of a www.losandes.com.ar/economia/hot-sale-donde-y-como-denunciar-en-caso-de-ser-victima-de-una-estafa/ page is used to inform the browser and visitors of the page about the general meta information. The head section of the page is where we place the page title, the definition of the HTML version used, the language of in which the page is written. In the head section we can also include JavaScript and CSS (markup) files for the page.
Page title
Title length
hot sale doacutende coacutemo denunciar caso ser viacutectima una estafa
Meta description
Meta description legth
Meta description SEO
desde defensa consumidor provincia realizaron una serie recomendaciones seguridad que hay olvidar hora comprar lnea adems comunicaron las vas denuncia caso ser estafados
Content SEO
Number of Words
Spam detected?
Headings
Heading distribution
Heading normalisation
Heading SEO impact
Emphasis (bold and italic)
Emphasis SEO impact
Images
Number of images
Images dimensions
Image alt descriptions
Images SEO impact
cerrar menu logo los andes facebook twitter instagram youtube redaccin direccin defensa consumidor brind tips para evitar estafas explic dnde recurrir caso ser engaados inflacin gondolas desde realizaron algunas recomendaciones empresa busca empleados trabajar durante hot sale fabrica fate cuidado con esta estafa whatsapp que promete mil viral tiktok vendedor ambulante mendocino estafado aguinaldo jubilados botas invierno lionel messi mercado pago meteoritos soar jess buen pastor vitral jueves cul signo mala suerte hoy risotto championes inteligencia artificial revel cmo vera gok vida real bicicleta trek avin tard despegar casi choca edificios tragedia junn muri joven motociclista tras chocar contra rbol gentileza ministerio seguridad rolando barbano confes consiguieron entrevista mximo thomsen rompe silencio hallaron cuerpo una mujer acantilados mar del plata investigan asesinaron yanina latorre hija defendieron ataques video pastelitos homicidio patitos kawaii jesica cirio javier milei marchi mara laura belvedere apareci nuevo yaguaret corrientes navegante rosarino logr primer argentino cruzar atlntico vela cuarto adzocalo white wyleex
Mobile SEO www.losandes.com.ar/economia/hot-sale-donde-y-como-denunciar-en-caso-de-ser-victima-de-una-estafa/
Mobile rendering
Mobile optimizations
Responsive design detected (mobile css)
No flash detected !
Mobile improvement
Marketing / lead generation for www.losandes.com.ar/economia/hot-sale-donde-y-como-denunciar-en-caso-de-ser-victima-de-una-estafa/
Social Media
Facebook shares | Facebook likes | ||
Facebook comments | Tweets | ||
Google +1 |
Conversion form
Search form
Analytics
Online presence
SERP Preview
SERP Title
The title is trucated
SERP Link
SERP Description
Domain Level SEO
Domain name
19 characters long
Domain name SEO Impact
los found in domain name !
nde found in domain name !
Path name
caso found in path !
con found in path !
denunciar found in path !
estafa found in path !
hot found in path !
nde found in path !
sale found in path !
ser found in path !
una found in path !
Structured data
Publisher Markup
Other Structured data
Website configuration
Correct processing of non-existing pages?
Favicon icon found?
HTML request without WWW redirected correctly?
Robots.txt found?
Sitemap found?
Navigation and internal links
Navigation
Url seperator
Human readable urls
Number of links
Link SEO Impact
ver promos de suscripcin
los andes
clasificados
auditorio
cmo anunciar
publicity
publicity
los andes san juan
|
autor redaccin los andes
oscar guilln
valentina porta
roco ledesma
maia had
lisandro tosello
|
economia por la recesin en abril el consumo masivo cay 204 interanual
hot sale hay varias promociones y descuentos pero escasa participacin de comercios mendocinos
fate dejar de exportar neumticos por prdida de competitividad y despedir a 97 empleados
jubilados y pensionados as qued el monto del mes de junio con bono y aguinaldo
chau plazo fijo cunto hay que invertir en mercado pago para obtener una ganancia de 250 mil
sorpresa por los precios en chile cunto sale una bicicleta de montaa trek
|
espectaculo escracharon a lola latorre por cheta tras confesar que nunca comi pastelitos qu dijo yanina latorre
viralizan el video de jesica cirio cuando compiti por ser la diosa tropical a los 16 aos
|
estilo chau zapatillas hola botas estos son los 3 modelos de calzado infaltables para no pasar fro en el invierno
patitos kawaii de dnde surge esta moda y por qu todo el mundo los usa
|
intent |
mas-deportes tena da libre pero lionel messi decidi demostrar por qu es el mejor del mundo
|
mundo un avin tard en despegar y casi se estrella contra los edificios
|
muy-tecno cuidado con esta estafa de whatsapp que promete 50 mil a cambio de calificar un hotel en google maps
|
policiales gendarmera evit que salieran de mendoza con destino a chile 77 meteoritos valuados en us 400000
tragedia en junn muri un motociclista tras chocar contra un rbol
revelaron los mensajes que envi mximo thomsen a una periodista tras la entrevista en telenoche
hallaron el cuerpo de una mujer en los acantilados de mar del plata e investigan si la asesinaron
piden 13 aos de crcel para un acusado de matar a un jinete durante una ria entre personas que iban a caballo
|
politica la continuidad de de marchi qued bajo la lupa con el ascenso de francos
|
por-las-redes alquil un departamento con vista al mar pero cuando lleg not que la haban estafado
un vendedor ambulante mendocino cont que lo estafaron se hizo viral y gener una campaa para ayudarlo
el reconfortante signficado de soar que ests volando
el evangelio de hoy 30 de mayo jess hijo de david ten compasin de m
jueves 30 cul es el signo con ms mala suerte hoy
la receta ideal para cocinar cuando tens invitados en casa segn la inteligencia artificial
la inteligencia artificial revel cmo se vera gok en la vida real y caus furor en los fanticos
|
services cartelera de cine
cartelera de espectculos
|
sharer |
sociedad edicin impresa
el vendedor ambulante que se hizo viral tras una estafa agradeci la ayuda me encantara tener mi propia cafetera
|
temas podcast
contenido exclusivo
estafa
compras
ofertas
defensa al consumidor
denuncia
|
www.losandes.com.ar sociedad
poltica
economa
opinin
deportes
policiales
fincas
arquitectura
editorial
escribe al lector
espectculos
estilo
muy tecno
mundo club house
sociales
turismo
vecinos
receptorias
por las redes
|
Links to external pages
Outloing links
losandes2.mitiendanube.com
www.guarda14.com
www.guarda14.com
losandespass.com.ar
www.rumbosdigital.com
losandes2.mitiendanube.com
tintero.com.ar
eventos.losandespass.com.ar
www.facebook.com
www.youtube.com
viapais.com.ar
viapais.com.ar
viapais.com.ar
viapais.com.ar
viapais.com.ar
www.lavoz.com.ar
www.lavoz.com.ar
www.clarin.com
www.ole.com.ar
entremujeres.clarin.com
www.viapais.com.ar
www.tycsports.com
tn.com.ar
www.ciudad.com.ar
www.eltrecetv.com.ar
radiomitre.cienradios.com
la100.cienradios.com
ar.cienradios.com
www.wyleex.com
SEO Advice for www.losandes.com.ar
In this section we provide pointers on how you can to optimize your web page so it can be found more easily by search engines and how to make it rank higher by optimizing the content of the page itself. For each of the individual criteria the maximum score is 100%. A score below 70% is considered to be indication that the page is not complying with general SEO standards and should be evaluated and/or fixed. Not every factor is weighted the same and some are not as important as others. Relatively unimportant factors like meta keywords are not included in the overall score.
Item | Factor | Pointers | |
---|---|---|---|
PageTitle | 100% | Far too many sites lack a page title. A page title is the first thing that shows in the search results so always use the title element. | |
Title relevance | 91% | A title should reflect the contents of a site. This site has a 70 % match | |
Title Length | 70% | Limit your title to anywhere between 40 and 70 characters. Your title was 91 characters long | |
Meta Description | 100% | A meta description is the second element that shows in the search results so always use the meta description. | |
Meta description length | 50% | The meta description should be between 145 and 160 characters. This meta description is 221 characters long. | |
Meta description relevance | 77% | Meta Description should reflect the contents of a site. This site has a 43 % match | |
Number of internal links | 50% | Linking to internal pages makes pages easier to find for search engines. Try to keep the number of links on your page roughly below 100. There are 165 internal links on this page. | |
Folder structure | 100% | We found a folder structure in the links on your page. A good folder structure makes a site easier to navigate. We found 15 level 1 folders and 20 folders above or in the first level of navigation. | |
Headings | 18% | Headers should reflect the contents of a site. This site has a 8 % match | |
Links | 12% | Link anchors should to some degree reflect the contents of a site. This site has a 6 % match | |
Image alt tags | 31% | Image alt tags should to some degree reflect the contents of a site. This site has a 11 % match | |
Bold and italic | 99% | Bold and italic tags should reflect the contents of a site to some degree. This site has a 33 % match | |
Html ratio | 30% | Try to keep the html / text ratio as low as possible. More html means longer loading times. Layout should be handled in a serpate css file | |
Image descriptions | 91% | 91.379310344828 % of all images have been described via the "alt" attribute. Describing images with relevant text may lead to better results in the search engines. | |
Page errors | 100% | Pages with no errors display significantly faster on most browsers. We detected 0 errors and warnings | |
WordCount | 35% | An ideal page contains between 400 and 600 words.This page contains 1410 words | |
Server response time | 30% | A slow server slows down a website. This server responds 819.16% slower the average | |
Gzip Compression | 100% | This site uses Gzip compression to display faster | |
Keywords in Domainname | 100% | There are important keywords in your domain name | |
Keywords in domain path | 100% | There are important keywords in the domain path | |
Structured Data | 100% | Structured data makes it easier for search engines to index your website | |
Inline css | 0% | Do not use inline css declarations. Inline css will slow down the rendering of the website. We detected 36 inline style declarations ( <a style="color:green">) with a size of 1159 bytes | |
Excessive use of the same words | 100% | There is no indication that there are one or more keywords that are used excessively. | |
Frames or iframes | 20% | The use of (i)frames can lead to problems crawling your page. Wij found 1 frame(s) on your page | |
Flash | 100% | Perfect, we detected no flash objects on your page | |
Css | 100% | Perfect, we did not detect too many CSS files | |
Javascript | 30% | Wij detected too much (10) blocking JavaScript files. Try to combine or defer the loading of JavaScript files | |
Mobile Website | 100% | Perfect, we found a responsive design for mobile users | |
Most important heading | 100% | Perfect, we detected a correct use of the most important (h1) heading! | |
Normalized headings | 40% | We dit not font a normalized heading structure. A heading 2 (h2) for example should be followed by a heading of an equal level (h2), a child heading (h3) or even a aprent heading (h1). |
How would you like to have SEO advice for all your pages ?? Start your SEO Dashboard and optimize your website!
www.losandes.com.ar images and descriptions
52 images found at www.losandes.com.ar Images can improve the user experience for a website by making a pag visually appealing Images can also add extra keyword relevance to a webpage by using alt tags. Images can also slow down a website. If the width and height for a picture is not specified for a browser know in advance how large the image is. A browser must first load the picture and see before it knows how much space should be on the page. Upon reservation In the meantime, the browser can do little but wait. When the height and width for the plate are given in the HTML code, a browser just continues to build for a page while the images load in the background.
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/close_white.svg?d=2194 height: 14px width: 12px description: cerrar |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/menu.svg?d=2194 height: 20px width: 17px description: menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/search.svg?d=2194 height: 20px width: 18px description: no alt description found |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/los-andes-140.svg?d=2194 height: 40px width: 160px description: los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/close.svg?d=2194 height: 18px width: 18px description: cerrar menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/chevron_down.svg?d=2194 height: 14px width: 12px description: no alt description found |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/facebook.svg?d=2194 height: 24px width: 24px description: facebook los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/x.svg?d=2194 height: 24px width: 24px description: twitter los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/instagram.svg?d=2194 height: 24px width: 24px description: instagram los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/youtube.svg?d=2194 height: 24px width: 24px description: youtube los andes |
|
https://www.losandes.com.ar/resizer/iuuu8a0ax-b3sx72bzfj1fuyvuc=/100x100/smart/s3.amazonaws.com/arc-authors/grupoclarin/3aad59e0-be62-4f05-a88d-4c88db2281b2.png height: 100px width: 100px description: redacción los andes |
|
https://www.losandes.com.ar/resizer/vvscghodhnasseklnuamlrdwdso=/0x0:0x0/980x640/filters:quality(80):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/r3xfov7fjbdtlc4trm4565j3ly.jpg height: 640px width: 980px description: la dirección de defensa al consumidor brindó 5 tips para evitar estafas y explicó dónde recurrir en caso de ser engañados. |
|
https://www.losandes.com.ar/resizer/6xl7blj1itmhnjrljwk6b3wvky0=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/vcmdnteg4rhzfcf3kgfecnx364.jpg height: 173px width: 307px description: inflación, gondolas |
|
https://www.losandes.com.ar/resizer/1vcjbt0q19qylgcty7dtbtmsr34=/1023x682/smart/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ekzjvayrt5axno46ym22jbj5iu.jpg height: 682px width: 1023px description: desde defensa al consumidor realizaron algunas recomendaciones para evitar estafas. |
|
https://www.losandes.com.ar/resizer/z-mys_wchk-qkzkuetvb0_8cwgc=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/wzqaa2vnongujlmmcgifgvqwgy.jpg height: 173px width: 307px description: qué empresa busca 500 empleados para trabajar durante el hot sale. |
|
https://www.losandes.com.ar/resizer/xurgmsshyvdtngjlyibpaut90sa=/307x173/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/rllcno5fibg4nh5iprdujwwdla.png height: 173px width: 307px description: fabrica fate |
|
https://www.losandes.com.ar/resizer/dg3cloyp4pw9bw7mh1v-g070cqs=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/r2i7it3ofra6ze5qhn33ocg5re.jpg height: 360px width: 640px description: cuidado con esta estafa de whatsapp que promete $ 50 mil |
|
https://www.losandes.com.ar/resizer/fooxtl_67mfhwu60tmviuhnzw9e=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/6goz6y6tpfhplowzsddn34qpci.png height: 360px width: 640px description: viral en tiktok |
|
https://www.losandes.com.ar/resizer/kethi301sokada_v8eeklke4vxm=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/jfaxfwt62fhv5ovbxuh7sfug2m.jpg height: 360px width: 640px description: vendedor ambulante mendocino |
|
https://www.losandes.com.ar/resizer/zltweprox22yffmwjkhho2pvlem=/640x360/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ktkniokezfcctk3qidbpzufche.jpg height: 360px width: 640px description: vendedor ambulante mendocino estafado |
|
https://www.losandes.com.ar/resizer/8uocdiq6gla4npqjy2x2jebdsdc=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/n2zsjz3fcvdtdcjw4xmo3rywxm.jpg height: 88px width: 156px description: aguinaldo jubilados |
|
https://www.losandes.com.ar/resizer/lkrujfs7pziv8uslvsv589onxi8=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/ieas54mzhvepbpin4egd6hkmt4.jpeg height: 88px width: 156px description: botas para el invierno |
|
https://www.losandes.com.ar/resizer/v93vemycb7fsuwtoiro56kpgitu=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/qqli542rwnbarhs55ae5pvnzke.jpg height: 88px width: 156px description: lionel messi |
|
https://www.losandes.com.ar/resizer/kt2hl2yyufd0hjvcse3ci3dxy2c=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/syh4x5yhafhythevgdmer6xqli.jpg height: 88px width: 156px description: mercado pago |
|
https://www.losandes.com.ar/resizer/xfeowdcbfess2ma3pnnpky3qqhs=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/gu75whtzpfemrbqrovoopdlryy.jpg height: 88px width: 156px description: meteoritos |
|
https://www.losandes.com.ar/resizer/davaq-axlizxeuw1x68jc04anhi=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/iwgra5dbxbdbrml6nqg6jnpoda.jpg height: 88px width: 156px description: soñar |
|
https://www.losandes.com.ar/resizer/jjyuujurcu2ivvxjtecmmzlwune=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/54xcuwx3uzhebdh4gdsg2bqraa.jpg height: 88px width: 156px description: jesús buen pastor vitral |
|
https://www.losandes.com.ar/resizer/pvnmtpv-otazekpvhdkqoq40w8g=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/aekxc4qxmzeq7jmd5fcghsllqu.jpeg height: 88px width: 156px description: jueves 30: cuál es el signo con más mala suerte hoy |
|
https://www.losandes.com.ar/resizer/bdzscxwigggoo3yg4olc8b0mb88=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/obdt3t4irrgahdxd22yh3p7d5m.png height: 88px width: 156px description: risotto con champiñones |
|
https://www.losandes.com.ar/resizer/lm7lc6uwbglw957tb3bs-sgtr-s=/156x88/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/cti4faabrrfb7o6puwqbmkugc4.png height: 88px width: 156px description: la inteligencia artificial reveló cómo se vería gokú en la vida real |
|
https://www.losandes.com.ar/resizer/gddjl2ip33jmhgymqj42f500b2c=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/apxlxwv65vgopp6f7aivdmopru.jpg height: 180px width: 360px description: bicicleta trek |
|
https://www.losandes.com.ar/resizer/c7nlfpciefeldsaubfuudq1s-e0=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/3p2g667gazerblllngrr7jomgm.png height: 180px width: 360px description: un avión tardó en despegar y casi choca a los edificios |
|
https://www.losandes.com.ar/resizer/ge-ganmr0b-ie-czlwgdiimq4f8=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/jbiefp3dwnggrdtjqtkz4sjlfq.jpg height: 180px width: 360px description: tragedia en junín. murió un joven motociclista tras chocar contra un árbol. gentileza: ministerio de seguridad |
|
https://www.losandes.com.ar/resizer/pyazbroc2yub_nipu9wunweut7y=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/zihjdy23lrcuxbc5galztfc4ee.jpg height: 180px width: 360px description: rolando barbano confesó cómo consiguieron la entrevista en la que máximo thomsen rompe el silencio |
|
https://www.losandes.com.ar/resizer/tqn4et8zjgk9d1nadvpqwj_4rkg=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/44uu3hxsojf4vno2nfwvwlb6h4.jpg height: 180px width: 320px description: hallaron el cuerpo de una mujer en los acantilados de mar del plata e investigan si la asesinaron |
|
https://www.losandes.com.ar/resizer/vox-qqqi0uk49rmpcnxmvubm5d4=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/5r53lxa4hjfazi54mlawhn4ury.jpg height: 180px width: 320px description: yanina latorre y su hija se defendieron de los ataques tras el video de los pastelitos. |
|
https://www.losandes.com.ar/resizer/blyl-bd9o__pllqcoec6ufnauci=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/uvcxt7x3g5gbdia3jkftmdm36u.jpg height: 180px width: 320px description: homicidio |
|
https://www.losandes.com.ar/resizer/hn_jtp0njjqt_vm_mkspatw-9he=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/nokn7ubx3zfyhavopvxlsyqswm.jpeg height: 180px width: 320px description: patitos kawaii |
|
https://www.losandes.com.ar/resizer/ks-w7nj_0dsus_zs5e2hn8w0qvq=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/fajs2xhvmrgpzlogync3okn6uu.jpg height: 180px width: 320px description: jesica cirio |
|
https://www.losandes.com.ar/resizer/czblg5w821tfgwx37w6icszxtgy=/320x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/54cskixmlja5rjpk7rbswlp45y.jpg height: 180px width: 320px description: javier milei de marchi |
|
https://www.losandes.com.ar/resizer/4pd-uuxhwfiwwuprsnceabjvjfa=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/c2jpyp4vh5garh2akpn2hq24dq.png height: 180px width: 360px description: maría laura belvedere |
|
https://www.losandes.com.ar/resizer/pkmm3bwg9ypos7m7qwmnadmlily=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/cf3r2dxtnfcv5legn37wit5si4.jpg height: 180px width: 360px description: apareció un nuevo yaguareté en corrientes. |
|
https://www.losandes.com.ar/resizer/wy1oaexjksg5acgpxbcsbgfart8=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/prbh4cujfzevtk7jo6k5y4q3vu.jpg height: 180px width: 360px description: el navegante rosarino que logró ser el primer argentino en cruzar el atlántico en vela. |
|
https://www.losandes.com.ar/resizer/p4yhfztqahwx892slhr608pmb1w=/360x180/smart/filters:quality(75):format(webp)/cloudfront-us-east-1.images.arcpublishing.com/grupoclarin/xfbbaqa2xbe2fcpyk3ab2ihyia.jpg height: 180px width: 360px description: río cuarto |
|
http://www.losandes.com.ar/data:image/png;base64,ivborw0kggoaaaansuheugaaaiaaaacacamaaad04jh5aaaaa3ncsvqicajb4u/
gaaaacxbiwxmaahycaab2hagnwnjqaaaagxrfwhrtb2z0d2fyzqb3d3cuaw5rc2nhcguub3jnm+48ggaaalhqtfrf/
///aaaaaqacaaaaaqacaaaaaqacaaaaaaaaaqacaqacaaaaaqacaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaqacaaa
aaaaaaqacaaaaaaaaaqacaaaaaaaaaqacaaaaaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaaaaaaaaaqacaaaaaaaaa
aaaaaaaaaaaaaaaaqacaaaaaqacaaaaaqacaaaaaqacaqacaaaaaqacaaaaaaaaaqacaaaeaqacaaaeaqacaaaeaaa
eaqacaqacaaadaqacaaadaaadaqacaaadaaadaaadaqacaqacaqacaaadaaadaqacaqacaaacaqacaaacaaacaaaca
qacaaacaqacaaacaaacaqacagacaqacaqacaqacagacaqacagacaqacagacaqacagacagacagacagacagacaqacaga
cagacaqacaqacagacagacaqacagacagacagacagacagacaqacaqacagacagacaqacaqacaqabaqabaqabaqabaqaca
qabaqacaqabaqacaqabaqabaqacaqabaqabaqacaqacaqacaqadaqacaqacaqadaqacaqadaqadaqacaqadaqacaqa
caqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqaca
qacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacaqacce3ibgaaamd
0uk5taaebawmebaugbggjcqolcwwmdq0odhesehqvfryxgbkahbwdhh8fisikjicokywumdayndu4otk8pt0+pz9aq
kndrudhsk5rulntvlhbw1xdzwzmaglpam9xc3r8fx+cgooehywgh4iiiymki4ynjo6plzawmpudnp+jpkwnqkmrrq+
xs7s0tbw2ulm6ury9v8hcwspfxsfjysvmzc7p0nht1nxw19na3d7f4ohj5oxm5+jq6+zt7u/w8vp09fb3+pn6+/z9/
gihbkwaaacvsurbvhjaxvvrqxvffp9bgeimkwlma5xuflncfacrcmguqifyipeskljqk9icfspcswsfmesim6+gfin
4qa2bzp+tpnb3zvbe2d2z2utzpu3doef8zt2zoxpomrlahejtcksbwjt7+4fgxob6eztbg0pzu+lxv1bszm37omglw
fbaznhpby9or+ganxxpvks8pxqa4dceuwmi0z0jg0opvqrkqifbv0twhrq+pwnskktjppsqww87bsjr6w0hgc84zyj
tuqzp8ikn7ztf7+loaayvq6tvbonouw/hdtlre3xu8qoo0sftdqvpcvbohlscuvbhhoyhxvhq+fv6gvrndfdmxnjxx
2rudk8eifrtuyspqaoa+t1fc9ykfhr1b02iqgil3u8m0hojpelmmqn8robop8jiybq26risj/e3ivkuwkwhsythw2u
sn/9strikgpxl1m6okviq3wirhshw6cpsayusrok1as4zvnksypbakj5vmcbqotnhvhdrrytcepqpyfjpli4sk1rbr
nujhd48aeeou0auepr/ll4v2asvt/axfgh8gzns92+mg2ekywf0rddxem302mqxqklfzjq+4zixwhlzj/irispnfoh
gz39qqzkfzsfklpwi6q1xzkqf6+5mhja236ud6/dheqn/fxrsfgaz/qbdtittbf3/jriqysqi46dtblmrop8phygnf
nq9vxyolzsjgnnaxft/cwokkbp/nwjaie7xvihha31x02nanm/peyes+hc0gdneywrleha8e2j8x4hpo0kalwq2zvb
vzrgce+dc5amrpbbsm31tu8mc39kvjjbnivnxgcf+wdxggiyxskmcv2zsmazju0alkkimdm7asi1yvshrdmkq6eegy
fxqv7bdgq0vbmiauzl8d4at/0wakdftnzl4rltgyywsqz5mx6cqu3jx7zlsem2jhl7hc2rljm1s/acjxp9chxqp++v
zkxyjobiv5atn9n0q4orzubr3uy0/zjdbn0wnbs4hjbsku0lyl364enme6vwqtbzfkoo0h5osrys8i3fwno3s+zep0
o/e8au5hhkkrjbfbct5r23+ufwmvfu+n3xeknzzroydmv+u2yted4927nue8ifyk+ozqd/rpp7olirtpsno49c94so
jvdsnyvr0uv9w7nydt2h96huv+acpoarbvwor8/daq7x/tdilpoqsfr/ldetd6j/7qf4/nvoajwvmgnofalhjqj0aa
mcowk9pq+ptphipbzbpslw6ghb5imj885q6pipnzkwatxyhaodmx6aox6jj0/cnfkc7oblibnazhuy2/6eypmlmbb4
dwcdz7e6rb1gkd1xx6b8ebojnwtoha7b+hed9+6yqpupm9ngaixsigydtdnfon02k+ciguumu+zgmaab20rtuzktq+
egzbxjraj4mibqavrtw+jilfcsyeqvomp07xokwhfztkao+yo5wnkdv/9qjyudycynhevjo8cu0wixkdehiy+zzj/j
omisv6pu/tciiy16vn3y0+kv60a9we1h63rm+qrx0y8j/vc+naguhvecj3i83hde5r0hp04qhfoikx9qnyof/xcz1a
1s7onrsa8nrlbtacrbwb4zb60tvb6hankwomow98xsnozijqub4obmz1ryriiuu5nri42eskqgrvlimwpzpf6fphyu
moiur/hlm4h/gc3/sx3uf8znlwdogyfepaxizsvt3irrabcsyivkgpvaaptywvl3qacykkwxkg/gbt2jaorjezhea8
zjhoyv/kxnlpk23vgszwitluokjh9+stvowcubbehoj1mwohzhkgy7mdjfakpqjj6cs/ifwpsjvadopsfcdlmmpchr
uga88w6stx1wnsktnogukr3zgewbpe78lvrvaiviiyfep8hhe/jsy7he2ikbei1skcsuhxqvp65odqj3gl1kjloke8
ie36imn0a0o+ifloofcjyv/sb3md2jaem+dpvtgodk9vcuid3xa+w4ut2mkltw6fauf8ygdlppyfbue4gk1s7m+jmf
3kzuj7gvke57vkhjlescni9rjcxxgxo+uex+xg7dh4bhl0yydd8z9lbdf5tlwtmwcn618po0argjjnskwjnocbdbyh
cghbbs2oxxgzw1zgecmaptto6eny92s+mcgh1msjzhtdhuxdlu3yd8ahmfmlkgcdowyhmemloy4qbutw6fn67d32nz
nqzchlv/2/xxglqfbfvna+/a9/gmm2o9w6d/eov0yj/6dtpqpcmk/zkb/oj/+a436j3rqp9sq/1iv/opn+o926z/cr
v94v/4ldvqveed7jrfov+aj/6ittf/1gv7lbtb+3q/qfuer0h7le9b+6rxqfu0xgo6lzwc0x/2eiq2x3wmf8pr/fzo
wq4z4gntdaaaaaelftksuqmcc height: height attribute not set width: width attribute not set description: adzocalo |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/los-andes-white.svg?d=2194 height: 28px width: 102px description: los andes white |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/chevron_up-white.svg?d=2194 height: 20px width: 16px description: menu |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/facebook-white.svg?d=2194 height: 24px width: 24px description: facebook los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/x-white.svg?d=2194 height: 24px width: 24px description: twitter los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/instagram-white.svg?d=2194 height: 24px width: 24px description: instagram los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/icons/youtube-white.svg?d=2194 height: 24px width: 24px description: youtube los andes |
|
http://www.losandes.com.ar/pf/resources/los-andes//images/wyleex.svg?d=2194 height: 20px width: 95px description: wyleex |
How are images contributing to your SEO site-wise ? Your leading content tool has the awnsers!